Rw2G024450

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
Physical Location & Seq
Reverse (-)
36082960 .. 36084824
1865 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G024450.1

Sequence Viewer

Length: 327 bp
ATGGTAGCTAATCTTCACTTAACGAAGCAAAGTTTTCAATTTTCAGGAATCATACAACCCGATGTTCAGCTTCTAAAAGTTCTAGAGATGCGCAAAAAAATGCTGCAGAAAGAGCAAGGTATGGCTTTTACTCGTGCTGTAGCAGTAGGTTTTGATGTTGATCATTTGCCACCATTAATATCATTTGCTGAATGCTTTGGGGCTTCATGCTTGATGGATGCTTGTAGAAGATATAAGGAACTGTGGAAACGAAAGCATGAGACTGGCCAATGGCTTGAAATTGAAAAAGCTAAAGCATGTCTAACCGAGCAGACTTCTCCGCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

12.37

Weight (kDa)

8.75

Isoelectric Point (pI)

68.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 92
AciI CCGC 1 cut(s) 320
AcoI YGGCCR 1 cut(s) 265
AgsI TTSAA 3 cut(s) 38, 278, 284
AluBI AGCT 3 cut(s) 8, 70, 290
AluI AGCT 3 cut(s) 8, 70, 290
Alw26I GTCTC 1 cut(s) 254
AoxI GGCC 1 cut(s) 265
ApeKI GCWGC 1 cut(s) 103
AseI ATTAAT 1 cut(s) 176
AspLEI GCGC 1 cut(s) 93
BalI TGGCCA 1 cut(s) 267
BarI GAAGNNNNNNTAC 1 cut(s) 29
BauI CACGAG 1 cut(s) 132
BbvI GCAGC 1 cut(s) 90
BccI CCATC 1 cut(s) 208
BclI TGATCA 1 cut(s) 160
BcoDI GTCTC 1 cut(s) 254
BfaI CTAG 1 cut(s) 83
BfmI CTRYAG 2 cut(s) 104, 138
BisI GCNGC 1 cut(s) 104
BlsI GCNGC 1 cut(s) 105
BmsI GCATC 2 cut(s) 78, 208
BsaBI GATNNNNATC 1 cut(s) 159
Bse1I ACTGG 1 cut(s) 268
Bse8I GATNNNNATC 1 cut(s) 159
BseGI GGATG 1 cut(s) 223
BseJI GATNNNNATC 1 cut(s) 159
BseNI ACTGG 1 cut(s) 268
BseXI GCAGC 1 cut(s) 90
BshFI GGCC 1 cut(s) 267
BsmAI GTCTC 1 cut(s) 254
BsmI GAATGC 1 cut(s) 197
BsnI GGCC 1 cut(s) 267
Bsp143I GATC 1 cut(s) 160
BspACI CCGC 1 cut(s) 320
BspANI GGCC 1 cut(s) 267
BspMAI CTGCAG 1 cut(s) 108
BsrI ACTGG 1 cut(s) 268
BssMI GATC 1 cut(s) 160
BssSI CACGAG 1 cut(s) 132
Bst2BI CACGAG 1 cut(s) 132
Bst4CI ACNGT 1 cut(s) 243
BstF5I GGATG 1 cut(s) 223
BstHHI GCGC 1 cut(s) 93
BstKTI GATC 1 cut(s) 163
BstMAI GTCTC 1 cut(s) 254
BstMBI GATC 1 cut(s) 160
BstMWI GCNNNNNNNGC 1 cut(s) 112
BstNSI RCATGY 1 cut(s) 300
BstSFI CTRYAG 2 cut(s) 104, 138
BstV1I GCAGC 1 cut(s) 90
BsuRI GGCC 1 cut(s) 267
BtsCI GGATG 1 cut(s) 223
CfoI GCGC 1 cut(s) 93
CviAII CATG 4 cut(s) 207, 257, 297, 324
CviJI RGCY 7 cut(s) 8, 70, 125, 203, 267, 274, 290
CviKI_1 RGCY 7 cut(s) 8, 70, 125, 203, 267, 274, 290
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
EaeI YGGCCR 1 cut(s) 265
EciI GGCGGA 1 cut(s) 309
FaeI CATG 4 cut(s) 210, 260, 300, 327
FaiI YATR 7 cut(s) 53, 122, 208, 234, 258, 298, 325
FatI CATG 4 cut(s) 206, 256, 296, 323
FbaI TGATCA 1 cut(s) 160
Fnu4HI GCNGC 1 cut(s) 104
FokI GGATG 1 cut(s) 230
Fsp4HI GCNGC 1 cut(s) 104
FspBI CTAG 1 cut(s) 83
FspI TGCGCA 1 cut(s) 92
GlaI GCGC 1 cut(s) 92
GluI GCNGC 1 cut(s) 104
HaeIII GGCC 1 cut(s) 267
HhaI GCGC 1 cut(s) 93
Hin1II CATG 4 cut(s) 210, 260, 300, 327
Hin6I GCGC 1 cut(s) 91
HinP1I GCGC 1 cut(s) 91
HinfI GANTC 1 cut(s) 48
Hpy188III TCNNGA 2 cut(s) 45, 83
HpyCH4III ACNGT 1 cut(s) 243
HpyCH4V TGCA 1 cut(s) 106
HpyF10VI GCNNNNNNNGC 1 cut(s) 112
Hsp92II CATG 4 cut(s) 210, 260, 300, 327
HspAI GCGC 1 cut(s) 91
Ksp22I TGATCA 1 cut(s) 160
Kzo9I GATC 1 cut(s) 160
LpnPI CCDG 2 cut(s) 30, 249
Lsp1109I GCAGC 1 cut(s) 90
LweI GCATC 2 cut(s) 78, 208
MaeI CTAG 1 cut(s) 83
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 2 cut(s) 5, 240
MlsI TGGCCA 1 cut(s) 267
MluCI AATT 2 cut(s) 38, 279
MluNI TGGCCA 1 cut(s) 267
Mox20I TGGCCA 1 cut(s) 267
MscI TGGCCA 1 cut(s) 267
MseI TTAA 2 cut(s) 20, 176
Msp20I TGGCCA 1 cut(s) 267
Mva1269I GAATGC 1 cut(s) 197
MwoI GCNNNNNNNGC 1 cut(s) 112
NdeII GATC 1 cut(s) 160
NlaIII CATG 4 cut(s) 210, 260, 300, 327
NsbI TGCGCA 1 cut(s) 92
NspI RCATGY 1 cut(s) 300
PctI GAATGC 1 cut(s) 197
PfeI GAWTC 1 cut(s) 48
PkrI GCNGC 1 cut(s) 105
PshBI ATTAAT 1 cut(s) 176
PstI CTGCAG 1 cut(s) 108
SaqAI TTAA 2 cut(s) 20, 176
SatI GCNGC 1 cut(s) 104
Sau3AI GATC 1 cut(s) 160
SetI ASST 5 cut(s) 10, 72, 121, 151, 292
SfaNI GCATC 2 cut(s) 78, 208
SfcI CTRYAG 2 cut(s) 104, 138
Sse9I AATT 2 cut(s) 38, 279
SsiI CCGC 1 cut(s) 320
SspMI CTAG 1 cut(s) 83
TaaI ACNGT 1 cut(s) 243
TasI AATT 2 cut(s) 38, 279
TfiI GAWTC 1 cut(s) 48
Tru1I TTAA 2 cut(s) 20, 176
Tru9I TTAA 2 cut(s) 20, 176
TseI GCWGC 1 cut(s) 103
TspDTI ATGAA 1 cut(s) 195
VspI ATTAAT 1 cut(s) 176
XbaI TCTAGA 1 cut(s) 82
XceI RCATGY 1 cut(s) 300
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.