Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0017704

Physical Location & Seq

Genomic Coordinates Reverse (-)

66899969 .. 66901117

Gene Structure 1149 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ51847

Sequence Viewer

CDS Protein Promoter (2k)

Length: 267 bp

ATGGTTTTTACTCGTACATGTGATGCAACACTCCTATTGGCTACGATGCTTCGAAATCTTGGTATAAGAGCCACCCCTATTAGTGGTCATATGAGCCAGTCAAAACGACTTGGTGCCTTAAATATGTTTAAAGCTGGAGAGTGTAATGTACTTATCTGCACTGATGTGGCAAGTAGAGGATTGGATATTCCGTTGGTGGATATGGATATTAATTATGATATTCCCTCAAATTCTAAGGAAAAGTATTTCCAGGTGATGCGGTCCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003724 GO:0003824 GO:0004004 GO:0004386 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0005737 GO:0006139 GO:0006364 GO:0006396 GO:0006725 GO:0006807 GO:0008026 GO:0008150 GO:0008152 GO:0008186 GO:0009987 GO:0010467 GO:0010501 GO:0016070 GO:0016072 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0022613 GO:0031974 GO:0031981 GO:0034470 GO:0034641 GO:0034660 GO:0042254 GO:0042623 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044085 GO:0044237 GO:0044238 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0046483 GO:0070013 GO:0070035 GO:0071704 GO:0071840 GO:0090304 GO:0140098 GO:1901360

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DEAD Helicase_C

Protein Analysis

88

Amino Acids

9.77

Weight (kDa)

8.57

Isoelectric Point (pI)

42.77

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Helicase_C	PF00271	1 - 85	1.1e-19	Helicase conserved C-terminal domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017704)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g47951 FvH4_6g52560
rosa_chinensis	RchiOBHm_Chr2g0149041
rosa_multiflora	Rmu_co8503557.1_g000001
rosa_roxburghii	Rroxscaffold_2G00121560
rosa_samantha	Rh1CG077300 Rh2BG095800 Rh2CG097700 Rh4DG259600 Rh5AG391900 Rh5DG408500 Rh7BG305700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	113
AciI	CCGC	1 cut(s)	259
AcsI	RAATTY	1 cut(s)	229
AfaI	GTAC	2 cut(s)	16, 150
AfiI	CCNNNNNNNGG	1 cut(s)	83
AflIII	ACRYGT	1 cut(s)	17
AjnI	CCWGG	1 cut(s)	249
AleI	CACNNNNGTG	1 cut(s)	164
AluBI	AGCT	1 cut(s)	134
AluI	AGCT	1 cut(s)	134
ApoI	RAATTY	1 cut(s)	229
AseI	ATTAAT	1 cut(s)	210
AspS9I	GGNCC	1 cut(s)	261
AsuHPI	GGTGA	1 cut(s)	265
AsuII	TTCGAA	1 cut(s)	52
AvaII	GGWCC	1 cut(s)	261
BanI	GGYRCC	1 cut(s)	113
BciT130I	CCWGG	1 cut(s)	251
BfaI	CTAG	1 cut(s)	265
Bme1390I	CCNGG	1 cut(s)	251
Bme18I	GGWCC	1 cut(s)	261
BmgT120I	GGNCC	1 cut(s)	261
BmiI	GGNNCC	1 cut(s)	115
BmrFI	CCNGG	1 cut(s)	251
BmsI	GCATC	3 cut(s)	13, 36, 246
BpmI	CTGGAG	1 cut(s)	156
Bpu14I	TTCGAA	1 cut(s)	52
Bsc4I	CCNNNNNNNGG	1 cut(s)	83
Bse1I	ACTGG	1 cut(s)	97
BseBI	CCWGG	1 cut(s)	251
BseLI	CCNNNNNNNGG	1 cut(s)	83
BseNI	ACTGG	1 cut(s)	97
BsgI	GTGCAG	1 cut(s)	142
BshNI	GGYRCC	1 cut(s)	113
BslI	CCNNNNNNNGG	1 cut(s)	83
Bsp119I	TTCGAA	1 cut(s)	52
BspACI	CCGC	1 cut(s)	259
BspLI	GGNNCC	1 cut(s)	115
BspT104I	TTCGAA	1 cut(s)	52
BspT107I	GGYRCC	1 cut(s)	113
BsrI	ACTGG	1 cut(s)	97
Bst2UI	CCWGG	1 cut(s)	251
BstBI	TTCGAA	1 cut(s)	52
BstDEI	CTNAG	1 cut(s)	234
BstNI	CCWGG	1 cut(s)	251
BstNSI	RCATGY	1 cut(s)	21
BstSCI	CCNGG	1 cut(s)	249
BtsIMutI	CAGTG	1 cut(s)	159
Cfr13I	GGNCC	1 cut(s)	261
Csp6I	GTAC	2 cut(s)	15, 149
CviAII	CATG	1 cut(s)	18
CviJI	RGCY	4 cut(s)	41, 71, 96, 134
CviKI_1	RGCY	4 cut(s)	41, 71, 96, 134
CviQI	GTAC	2 cut(s)	15, 149
DdeI	CTNAG	1 cut(s)	234
DraI	TTTAAA	1 cut(s)	130
Eco47I	GGWCC	1 cut(s)	261
EcoRII	CCWGG	1 cut(s)	249
FaeI	CATG	1 cut(s)	21
FaiI	YATR	7 cut(s)	19, 65, 90, 92, 125, 203, 216
FatI	CATG	1 cut(s)	17
FauNDI	CATATG	1 cut(s)	90
FspBI	CTAG	1 cut(s)	265
GsuI	CTGGAG	1 cut(s)	156
Hin1II	CATG	1 cut(s)	21
HphI	GGTGA	1 cut(s)	265
HpyCH4V	TGCA	2 cut(s)	26, 159
HpyF3I	CTNAG	1 cut(s)	234
Hsp92II	CATG	1 cut(s)	21
LpnPI	CCDG	4 cut(s)	110, 120, 236, 263
LweI	GCATC	3 cut(s)	13, 36, 246
MaeI	CTAG	1 cut(s)	265
MluCI	AATT	2 cut(s)	211, 229
MnlI	CCTC	2 cut(s)	170, 235
MseI	TTAA	3 cut(s)	119, 129, 210
MslI	CAYNNNNRTG	1 cut(s)	164
MspR9I	CCNGG	1 cut(s)	251
MvaI	CCWGG	1 cut(s)	251
NdeI	CATATG	1 cut(s)	90
NlaIII	CATG	1 cut(s)	21
NlaIV	GGNNCC	1 cut(s)	115
NspI	RCATGY	1 cut(s)	21
NspV	TTCGAA	1 cut(s)	52
OliI	CACNNNNGTG	1 cut(s)	164
PciI	ACATGT	1 cut(s)	17
PscI	ACATGT	1 cut(s)	17
PshBI	ATTAAT	1 cut(s)	210
Psp6I	CCWGG	1 cut(s)	249
PspGI	CCWGG	1 cut(s)	249
PspN4I	GGNNCC	1 cut(s)	115
PspPI	GGNCC	1 cut(s)	261
RsaI	GTAC	2 cut(s)	16, 150
RsaNI	GTAC	2 cut(s)	15, 149
RseI	CAYNNNNRTG	1 cut(s)	164
SaqAI	TTAA	3 cut(s)	119, 129, 210
Sau96I	GGNCC	1 cut(s)	261
ScrFI	CCNGG	1 cut(s)	251
SetI	ASST	2 cut(s)	136, 255
SfaNI	GCATC	3 cut(s)	13, 36, 246
SfuI	TTCGAA	1 cut(s)	52
SgeI	CNNG	9 cut(s)	24, 30, 71, 109, 122, 147, 183, 262, 263
SinI	GGWCC	1 cut(s)	261
SmiMI	CAYNNNNRTG	1 cut(s)	164
Sse9I	AATT	2 cut(s)	211, 229
SsiI	CCGC	1 cut(s)	259
SspMI	CTAG	1 cut(s)	265
StyD4I	CCNGG	1 cut(s)	249
TaqI	TCGA	1 cut(s)	52
TasI	AATT	2 cut(s)	211, 229
TatI	WGTACW	1 cut(s)	148
Tru1I	TTAA	3 cut(s)	119, 129, 210
Tru9I	TTAA	3 cut(s)	119, 129, 210
TscAI	CASTG	1 cut(s)	166
TspGWI	ACGGA	1 cut(s)	180
TspRI	CASTG	1 cut(s)	166
VpaK11BI	GGWCC	1 cut(s)	261
VspI	ATTAAT	1 cut(s)	210
XapI	RAATTY	1 cut(s)	229
XceI	RCATGY	1 cut(s)	21
XspI	CTAG	1 cut(s)	265

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.