RchiOBHm_Chr3g0459541

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
7942154 .. 7942444
291 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ42613

Sequence Viewer

Length: 177 bp
ATGACTTATTTTTCTTCTTTCTTGGTTCTTGCAGGGTTGCAAAATCCGCTCAATATTGCAAAGTTATTCTGGACACTGTTGAATCTTCATTACCAGGCGGTTTACCTCAAAATGAAAGAGAGAGTGAAGGAGGGAAGTAAAAACATAGGGGAAGATGGTCTTCTTGGATGGACGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.66

Weight (kDa)

9.16

Isoelectric Point (pI)

40.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 49
AciI CCGC 2 cut(s) 47, 98
AgsI TTSAA 1 cut(s) 82
AjiI CACGTC 1 cut(s) 174
AjnI CCWGG 1 cut(s) 93
BbsI GAAGAC 1 cut(s) 152
BccI CCATC 2 cut(s) 149, 162
BciT130I CCWGG 1 cut(s) 95
Bme1390I CCNGG 1 cut(s) 95
BmgBI CACGTC 1 cut(s) 174
BmrFI CCNGG 1 cut(s) 95
BpiI GAAGAC 1 cut(s) 152
BseBI CCWGG 1 cut(s) 95
BseGI GGATG 1 cut(s) 173
BspACI CCGC 2 cut(s) 47, 98
BsrBI CCGCTC 1 cut(s) 49
Bst2UI CCWGG 1 cut(s) 95
Bst4CI ACNGT 1 cut(s) 78
BstF5I GGATG 1 cut(s) 173
BstMWI GCNNNNNNNGC 1 cut(s) 46
BstNI CCWGG 1 cut(s) 95
BstSCI CCNGG 1 cut(s) 93
BstV2I GAAGAC 1 cut(s) 152
BtrI CACGTC 1 cut(s) 174
BtsCI GGATG 1 cut(s) 173
BtsIMutI CAGTG 1 cut(s) 74
EcoRII CCWGG 1 cut(s) 93
FaiI YATR 1 cut(s) 146
FalI AAGNNNNNCTT 2 cut(s) 144, 176
HinfI GANTC 1 cut(s) 82
Hpy166II GTNNAC 1 cut(s) 103
Hpy188III TCNNGA 1 cut(s) 70
Hpy8I GTNNAC 1 cut(s) 103
HpyAV CCTTC 1 cut(s) 121
HpyCH4III ACNGT 1 cut(s) 78
HpyCH4IV ACGT 1 cut(s) 173
HpyCH4V TGCA 3 cut(s) 32, 40, 59
HpyF10VI GCNNNNNNNGC 1 cut(s) 46
HpySE526I ACGT 1 cut(s) 173
LpnPI CCDG 4 cut(s) 18, 55, 80, 107
MaeII ACGT 1 cut(s) 173
MbiI CCGCTC 1 cut(s) 49
MboII GAAGA 4 cut(s) 6, 77, 152, 164
MnlI CCTC 2 cut(s) 116, 124
MspR9I CCNGG 1 cut(s) 95
MvaI CCWGG 1 cut(s) 95
MwoI GCNNNNNNNGC 1 cut(s) 46
PfeI GAWTC 1 cut(s) 82
Psp6I CCWGG 1 cut(s) 93
PspGI CCWGG 1 cut(s) 93
ScrFI CCNGG 1 cut(s) 95
SetI ASST 2 cut(s) 108, 176
SgeI CNNG 6 cut(s) 34, 41, 45, 82, 106, 107
SsiI CCGC 2 cut(s) 47, 98
SspI AATATT 1 cut(s) 55
StyD4I CCNGG 1 cut(s) 93
TaaI ACNGT 1 cut(s) 78
TaiI ACGT 1 cut(s) 176
TfiI GAWTC 1 cut(s) 82
TscAI CASTG 1 cut(s) 81
TspDTI ATGAA 2 cut(s) 77, 128
TspRI CASTG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.