Rh4AG182000

Cytochrome p450

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
45361493 .. 45368860
7368 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG182000.1

Sequence Viewer

Length: 195 bp
ATGATTAGACTGGAGATTTGGGCAAATCCAGACATACCAATGAATCTAGATGTAGAAGGATCGAAGAGAGAATACGACAACAAAGGGCCAATTAACCTCAAAATGAAGGACAAAGTGAAGAAGGAAAGTAAAAACATAGGGGAAAATGATCTCCTTGGATGGATTTTCAAGCATTCAAATCCATCCAAGCTTTAG

Protein Analysis

64

Amino Acids

7.44

Weight (kDa)

9.0

Isoelectric Point (pI)

28.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 67
AgsI TTSAA 2 cut(s) 169, 177
AluBI AGCT 1 cut(s) 190
AluI AGCT 1 cut(s) 190
AlwI GGATC 1 cut(s) 67
AoxI GGCC 1 cut(s) 86
ArsI GACNNNNNNTTYG 1 cut(s) 32
AspS9I GGNCC 1 cut(s) 86
BarI GAAGNNNNNNTAC 2 cut(s) 56, 88
BccI CCATC 2 cut(s) 153, 190
BfaI CTAG 1 cut(s) 47
BmgT120I GGNCC 1 cut(s) 86
BpmI CTGGAG 1 cut(s) 32
BsaJI CCNNGG 1 cut(s) 154
Bse1I ACTGG 1 cut(s) 15
BseDI CCNNGG 1 cut(s) 154
BseGI GGATG 2 cut(s) 164, 182
BseNI ACTGG 1 cut(s) 15
BshFI GGCC 1 cut(s) 88
BsmI GAATGC 1 cut(s) 172
BsnI GGCC 1 cut(s) 88
Bsp143I GATC 2 cut(s) 59, 148
BspANI GGCC 1 cut(s) 88
BspPI GGATC 1 cut(s) 67
BsrI ACTGG 1 cut(s) 15
BssECI CCNNGG 1 cut(s) 154
BssMI GATC 2 cut(s) 59, 148
BssT1I CCWWGG 1 cut(s) 154
Bst6I CTCTTC 1 cut(s) 59
BstF5I GGATG 2 cut(s) 164, 182
BstKTI GATC 2 cut(s) 62, 151
BstMBI GATC 2 cut(s) 59, 148
BsuRI GGCC 1 cut(s) 88
BtsCI GGATG 2 cut(s) 164, 182
Cfr13I GGNCC 1 cut(s) 86
CviJI RGCY 2 cut(s) 88, 190
CviKI_1 RGCY 2 cut(s) 88, 190
DpnI GATC 2 cut(s) 61, 150
DpnII GATC 2 cut(s) 59, 148
Eam1104I CTCTTC 1 cut(s) 59
EarI CTCTTC 1 cut(s) 59
Eco130I CCWWGG 1 cut(s) 154
EcoT14I CCWWGG 1 cut(s) 154
ErhI CCWWGG 1 cut(s) 154
FaiI YATR 2 cut(s) 35, 137
FokI GGATG 2 cut(s) 169, 171
FspBI CTAG 1 cut(s) 47
GsuI CTGGAG 1 cut(s) 32
HaeIII GGCC 1 cut(s) 88
HindIII AAGCTT 1 cut(s) 188
HinfI GANTC 1 cut(s) 43
Hpy188III TCNNGA 2 cut(s) 29, 47
HpyAV CCTTC 3 cut(s) 50, 100, 115
Kzo9I GATC 2 cut(s) 59, 148
LpnPI CCDG 1 cut(s) 42
MaeI CTAG 1 cut(s) 47
MalI GATC 2 cut(s) 61, 150
MboI GATC 2 cut(s) 59, 148
MboII GAAGA 2 cut(s) 76, 130
MluCI AATT 1 cut(s) 90
MnlI CCTC 1 cut(s) 107
MseI TTAA 1 cut(s) 93
MslI CAYNNNNRTG 1 cut(s) 38
Mva1269I GAATGC 1 cut(s) 172
NdeII GATC 2 cut(s) 59, 148
PctI GAATGC 1 cut(s) 172
PfeI GAWTC 1 cut(s) 43
PspPI GGNCC 1 cut(s) 86
RseI CAYNNNNRTG 1 cut(s) 38
SaqAI TTAA 1 cut(s) 93
Sau3AI GATC 2 cut(s) 59, 148
Sau96I GGNCC 1 cut(s) 86
SetI ASST 2 cut(s) 99, 192
SgeI CNNG 5 cut(s) 23, 41, 59, 167, 181
SmiMI CAYNNNNRTG 1 cut(s) 38
Sse9I AATT 1 cut(s) 90
SspMI CTAG 1 cut(s) 47
StyI CCWWGG 1 cut(s) 154
TaqI TCGA 1 cut(s) 62
TasI AATT 1 cut(s) 90
TfiI GAWTC 1 cut(s) 43
Tru1I TTAA 1 cut(s) 93
Tru9I TTAA 1 cut(s) 93
TspDTI ATGAA 2 cut(s) 56, 119
XbaI TCTAGA 1 cut(s) 46
XspI CTAG 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.