Rh4AG165500

Cytochrome p450

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
41793989 .. 41797051
3063 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG165500.1

Sequence Viewer

Length: 237 bp
ATGGAAGAGAGAGTGAAGGAGGGAAGTAAAAACATAGGGGAACATGATCTTCTTGGATGGATTTTGAAGCATTCAAATCTTTCAAAGGAGCAAATTCTTGACTTGATATTGAAGCTGCTCCTCGAAACTTCATCAGTATCTATGGCTTTAGTCATATATTTCTTGCCTGGCTGTCCTAATGCAATTAAACACTTAGCGGATGATAAGCCGGATGAGAGCCTCCATCACAACATGTAA

Protein Analysis

78

Amino Acids

8.82

Weight (kDa)

5.63

Isoelectric Point (pI)

34.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 197
AcsI RAATTY 1 cut(s) 93
AflIII ACRYGT 1 cut(s) 231
AgsI TTSAA 4 cut(s) 67, 75, 84, 112
AjnI CCWGG 1 cut(s) 166
AluBI AGCT 1 cut(s) 115
AluI AGCT 1 cut(s) 115
ApeKI GCWGC 1 cut(s) 115
ApoI RAATTY 1 cut(s) 93
BbvI GCAGC 1 cut(s) 102
BccI CCATC 2 cut(s) 51, 231
BciT130I CCWGG 1 cut(s) 168
BisI GCNGC 1 cut(s) 116
BlsI GCNGC 1 cut(s) 117
Bme1390I CCNGG 1 cut(s) 168
BmrFI CCNGG 1 cut(s) 168
BseBI CCWGG 1 cut(s) 168
BseGI GGATG 3 cut(s) 62, 205, 217
BseRI GAGGAG 1 cut(s) 110
BseXI GCAGC 1 cut(s) 102
BsiSI CCGG 1 cut(s) 209
BsmI GAATGC 1 cut(s) 70
Bsp143I GATC 1 cut(s) 46
BspACI CCGC 1 cut(s) 197
BssMI GATC 1 cut(s) 46
Bst2UI CCWGG 1 cut(s) 168
BstDEI CTNAG 1 cut(s) 193
BstF5I GGATG 3 cut(s) 62, 205, 217
BstKTI GATC 1 cut(s) 49
BstMBI GATC 1 cut(s) 46
BstNI CCWGG 1 cut(s) 168
BstNSI RCATGY 1 cut(s) 235
BstSCI CCNGG 1 cut(s) 166
BstV1I GCAGC 1 cut(s) 102
BtsCI GGATG 3 cut(s) 62, 205, 217
CviAII CATG 2 cut(s) 44, 232
CviJI RGCY 5 cut(s) 115, 146, 171, 208, 219
CviKI_1 RGCY 5 cut(s) 115, 146, 171, 208, 219
DdeI CTNAG 1 cut(s) 193
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
EcoRII CCWGG 1 cut(s) 166
FaeI CATG 2 cut(s) 47, 235
FaiI YATR 6 cut(s) 35, 45, 143, 155, 157, 233
FatI CATG 2 cut(s) 43, 231
Fnu4HI GCNGC 1 cut(s) 116
FokI GGATG 3 cut(s) 69, 212, 224
Fsp4HI GCNGC 1 cut(s) 116
GluI GCNGC 1 cut(s) 116
HapII CCGG 1 cut(s) 209
Hin1II CATG 2 cut(s) 47, 235
HpaII CCGG 1 cut(s) 209
Hpy188III TCNNGA 1 cut(s) 98
HpyAV CCTTC 1 cut(s) 10
HpyCH4V TGCA 1 cut(s) 182
HpyF3I CTNAG 1 cut(s) 193
Hsp92II CATG 2 cut(s) 47, 235
Kzo9I GATC 1 cut(s) 46
LmnI GCTCC 2 cut(s) 88, 123
LpnPI CCDG 3 cut(s) 153, 180, 222
Lsp1109I GCAGC 1 cut(s) 102
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 2 cut(s) 17, 41
MluCI AATT 2 cut(s) 93, 183
MnlI CCTC 3 cut(s) 13, 131, 230
MseI TTAA 1 cut(s) 186
MspI CCGG 1 cut(s) 209
MspR9I CCNGG 1 cut(s) 168
Mva1269I GAATGC 1 cut(s) 70
MvaI CCWGG 1 cut(s) 168
NdeII GATC 1 cut(s) 46
NlaIII CATG 2 cut(s) 47, 235
NspI RCATGY 1 cut(s) 235
PciI ACATGT 1 cut(s) 231
PctI GAATGC 1 cut(s) 70
PkrI GCNGC 1 cut(s) 117
PscI ACATGT 1 cut(s) 231
Psp6I CCWGG 1 cut(s) 166
PspGI CCWGG 1 cut(s) 166
SaqAI TTAA 1 cut(s) 186
SatI GCNGC 1 cut(s) 116
Sau3AI GATC 1 cut(s) 46
ScrFI CCNGG 1 cut(s) 168
SetI ASST 1 cut(s) 117
SgeI CNNG 9 cut(s) 56, 65, 110, 115, 134, 175, 179, 180, 221
Sse9I AATT 2 cut(s) 93, 183
SsiI CCGC 1 cut(s) 197
StyD4I CCNGG 1 cut(s) 166
TaqI TCGA 1 cut(s) 123
TasI AATT 2 cut(s) 93, 183
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TseI GCWGC 1 cut(s) 115
TspDTI ATGAA 1 cut(s) 120
XapI RAATTY 1 cut(s) 93
XceI RCATGY 1 cut(s) 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.