RchiOBHm_Chr4g0410101

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
33782113 .. 33782600
488 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38107

Sequence Viewer

Length: 150 bp
ATGCTGCAGTTTCGAGCAATAGCTGATCAGTTTTTCGCAATCCAGATTACCATAAGCATGTTAGAAAGCAGGTATGACAGATCAAAGGCATCTACTTCATTCCTCATGTTAGCTCTTTCCCCTGATAGGCATTTCTTTACCTTGCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.73

Weight (kDa)

8.36

Isoelectric Point (pI)

37.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 60
AfiI CCNNNNNNNGG 1 cut(s) 126
AluBI AGCT 2 cut(s) 23, 113
AluI AGCT 2 cut(s) 23, 113
ApeKI GCWGC 1 cut(s) 4
BclI TGATCA 1 cut(s) 25
BfmI CTRYAG 1 cut(s) 5
BfuAI ACCTGC 1 cut(s) 60
BisI GCNGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 6
BmsI GCATC 1 cut(s) 98
Bsc4I CCNNNNNNNGG 1 cut(s) 126
BseLI CCNNNNNNNGG 1 cut(s) 126
BslI CCNNNNNNNGG 1 cut(s) 126
Bsp143I GATC 2 cut(s) 25, 80
BspMAI CTGCAG 1 cut(s) 9
BspMI ACCTGC 1 cut(s) 60
BssMI GATC 2 cut(s) 25, 80
BstKTI GATC 2 cut(s) 28, 83
BstMBI GATC 2 cut(s) 25, 80
BstNSI RCATGY 1 cut(s) 61
BstSFI CTRYAG 1 cut(s) 5
BveI ACCTGC 1 cut(s) 60
CviAII CATG 2 cut(s) 58, 106
CviJI RGCY 2 cut(s) 23, 113
CviKI_1 RGCY 2 cut(s) 23, 113
DpnI GATC 2 cut(s) 27, 82
DpnII GATC 2 cut(s) 25, 80
FaeI CATG 2 cut(s) 61, 109
FaiI YATR 4 cut(s) 53, 59, 75, 107
FatI CATG 2 cut(s) 57, 105
FbaI TGATCA 1 cut(s) 25
Fnu4HI GCNGC 1 cut(s) 5
Fsp4HI GCNGC 1 cut(s) 5
FspEI CC 9 cut(s) 55, 56, 64, 71, 112, 116, 133, 134, 135
GluI GCNGC 1 cut(s) 5
Hin1II CATG 2 cut(s) 61, 109
Hpy188III TCNNGA 1 cut(s) 43
HpyCH4V TGCA 1 cut(s) 7
Hsp92II CATG 2 cut(s) 61, 109
Ksp22I TGATCA 1 cut(s) 25
Kzo9I GATC 2 cut(s) 25, 80
LpnPI CCDG 3 cut(s) 55, 56, 135
LweI GCATC 1 cut(s) 98
MalI GATC 2 cut(s) 27, 82
MboI GATC 2 cut(s) 25, 80
MnlI CCTC 1 cut(s) 113
MslI CAYNNNNRTG 1 cut(s) 56
NdeII GATC 2 cut(s) 25, 80
NlaIII CATG 2 cut(s) 61, 109
NspI RCATGY 1 cut(s) 61
PkrI GCNGC 1 cut(s) 6
PstI CTGCAG 1 cut(s) 9
RseI CAYNNNNRTG 1 cut(s) 56
SatI GCNGC 1 cut(s) 5
Sau3AI GATC 2 cut(s) 25, 80
SetI ASST 4 cut(s) 25, 74, 115, 143
SfaNI GCATC 1 cut(s) 98
SfcI CTRYAG 1 cut(s) 5
SgeI CNNG 6 cut(s) 26, 55, 70, 82, 118, 134
SmiMI CAYNNNNRTG 1 cut(s) 56
TaqI TCGA 1 cut(s) 13
TseI GCWGC 1 cut(s) 4
TspDTI ATGAA 1 cut(s) 87
XceI RCATGY 1 cut(s) 61
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.