Rroxscaffold_7G00197180

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
41010445 .. 41011998
1554 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00197180.1

Sequence Viewer

Length: 288 bp
ATGCAAGACCAGATGTTTCAATCAATCATTGAATATAATGGTTTTAAAATAGTTTGTAGGATGATAATGAGTATTCCCTTTCAAAAATTTGGAGTAGAGACATACAGTGTTGAAAAGGGATTCACTCTCGGATTACACTTTTGCTCTGAATCCCTGTGTATAAAACTGACATCTCCAACTGCTTTCCAATTCGAGAAGCCTCCATCAAAGTCACCATCTGCTTTCCAATTCGAGAAGTCTCCATCAAAGCCTCCCTGGGTAAAATTTCCCTTTCATACAATGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

10.97

Weight (kDa)

8.86

Isoelectric Point (pI)

44.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 86, 263
AgsI TTSAA 4 cut(s) 20, 32, 83, 113
AjnI CCWGG 1 cut(s) 254
Alw26I GTCTC 2 cut(s) 92, 243
ApoI RAATTY 2 cut(s) 86, 263
AsuHPI GGTGA 1 cut(s) 204
BccI CCATC 3 cut(s) 211, 223, 250
BciT130I CCWGG 1 cut(s) 256
BcoDI GTCTC 2 cut(s) 92, 243
Bme1390I CCNGG 1 cut(s) 256
BmrFI CCNGG 1 cut(s) 256
BsaJI CCNNGG 2 cut(s) 254, 255
BseBI CCWGG 1 cut(s) 256
BseDI CCNNGG 2 cut(s) 254, 255
BseGI GGATG 1 cut(s) 66
BsmAI GTCTC 2 cut(s) 92, 243
BssECI CCNNGG 2 cut(s) 254, 255
Bst2UI CCWGG 1 cut(s) 256
Bst4CI ACNGT 1 cut(s) 107
BstF5I GGATG 1 cut(s) 66
BstMAI GTCTC 2 cut(s) 92, 243
BstNI CCWGG 1 cut(s) 256
BstSCI CCNGG 1 cut(s) 254
BtsCI GGATG 1 cut(s) 66
BtsIMutI CAGTG 1 cut(s) 112
CviJI RGCY 2 cut(s) 199, 250
CviKI_1 RGCY 2 cut(s) 199, 250
DraI TTTAAA 1 cut(s) 46
EcoRII CCWGG 1 cut(s) 254
FaiI YATR 4 cut(s) 36, 103, 161, 276
FokI GGATG 1 cut(s) 73
HinfI GANTC 2 cut(s) 120, 149
HphI GGTGA 1 cut(s) 204
Hpy188I TCNGA 2 cut(s) 131, 148
Hpy188III TCNNGA 2 cut(s) 193, 232
HpyCH4III ACNGT 1 cut(s) 107
HpyCH4V TGCA 1 cut(s) 4
LpnPI CCDG 4 cut(s) 23, 167, 241, 268
MaeIII GTNAC 1 cut(s) 210
MluCI AATT 5 cut(s) 86, 188, 227, 263, 283
MmeI TCCRAC 1 cut(s) 200
MnlI CCTC 2 cut(s) 210, 261
MseI TTAA 1 cut(s) 45
MspR9I CCNGG 1 cut(s) 256
MvaI CCWGG 1 cut(s) 256
NmuCI GTSAC 1 cut(s) 210
PasI CCCWGGG 1 cut(s) 255
PfeI GAWTC 2 cut(s) 120, 149
Psp6I CCWGG 1 cut(s) 254
PspGI CCWGG 1 cut(s) 254
SaqAI TTAA 1 cut(s) 45
ScrFI CCNGG 1 cut(s) 256
SgeI CNNG 8 cut(s) 17, 22, 140, 166, 205, 244, 267, 268
Sse9I AATT 5 cut(s) 86, 188, 227, 263, 283
StyD4I CCNGG 1 cut(s) 254
TaaI ACNGT 1 cut(s) 107
TaqI TCGA 2 cut(s) 192, 231
TasI AATT 5 cut(s) 86, 188, 227, 263, 283
TfiI GAWTC 2 cut(s) 120, 149
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TscAI CASTG 1 cut(s) 112
TseFI GTSAC 1 cut(s) 210
Tsp45I GTSAC 1 cut(s) 210
TspDTI ATGAA 1 cut(s) 263
TspRI CASTG 1 cut(s) 112
XapI RAATTY 2 cut(s) 86, 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.