Rh4DG177600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Forward (+)
35172075 .. 35178258
6184 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG177600.1

Sequence Viewer

Length: 393 bp
ATGCGATATAATTGTAAGAGCCAGGGTTTGTCCAGAGTATCAAGGTTTGGGAGGGATCTTTCACCAAAAGAAGAGCTGTGGCTTGCTTTTGATTTTTGTGGATGCGTGGCCTTCATTTCTGTTCAACTGAAGCCCCTCAGTTCGATTCAGAGTTTTCATGTAGATCGAGAAGAAAGAGATCCAAGATTTCAGAACCAACCCATCTTTTCAAACAAAGTTTACGAAAGAGACATACCAATGAATCTAGATGTAGAAGGATCGAAGAGAGAATACGACAACAAAGGGCCAATTAACCTCAAAATGAAGGACAAAGTGAAGAAGGAAAGTAAAAACATAGGGGAAAATGATCTCCTTGGATGGATTTTCAAGCATTCAAATCCATCCAAGCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

130

Amino Acids

15.18

Weight (kDa)

9.17

Isoelectric Point (pI)

35.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 63, 173, 265
AcuI CTGAAG 1 cut(s) 149
AgsI TTSAA 4 cut(s) 125, 210, 367, 375
AjnI CCWGG 1 cut(s) 21
AluBI AGCT 2 cut(s) 76, 388
AluI AGCT 2 cut(s) 76, 388
Alw26I GTCTC 1 cut(s) 222
AlwI GGATC 3 cut(s) 63, 173, 265
AoxI GGCC 2 cut(s) 108, 284
AspS9I GGNCC 1 cut(s) 284
AsuHPI GGTGA 1 cut(s) 54
BarI GAAGNNNNNNTAC 2 cut(s) 254, 286
BccI CCATC 3 cut(s) 209, 351, 388
BciT130I CCWGG 1 cut(s) 23
BcoDI GTCTC 1 cut(s) 222
BfaI CTAG 1 cut(s) 245
Bme1390I CCNGG 1 cut(s) 23
BmgT120I GGNCC 1 cut(s) 284
BmrFI CCNGG 1 cut(s) 23
BmsI GCATC 1 cut(s) 92
BsaJI CCNNGG 2 cut(s) 22, 352
BseBI CCWGG 1 cut(s) 23
BseDI CCNNGG 2 cut(s) 22, 352
BseGI GGATG 3 cut(s) 107, 362, 380
BseMII CTCAG 1 cut(s) 151
BshFI GGCC 2 cut(s) 110, 286
BsmAI GTCTC 1 cut(s) 222
BsmI GAATGC 1 cut(s) 370
BsnI GGCC 2 cut(s) 110, 286
Bsp143I GATC 5 cut(s) 55, 163, 178, 257, 346
BspANI GGCC 2 cut(s) 110, 286
BspCNI CTCAG 1 cut(s) 150
BspPI GGATC 3 cut(s) 63, 173, 265
BspQI GCTCTTC 1 cut(s) 66
BssECI CCNNGG 2 cut(s) 22, 352
BssMI GATC 5 cut(s) 55, 163, 178, 257, 346
BssT1I CCWWGG 1 cut(s) 352
Bst2UI CCWGG 1 cut(s) 23
Bst6I CTCTTC 2 cut(s) 66, 257
BstC8I GCNNGC 1 cut(s) 84
BstDEI CTNAG 1 cut(s) 137
BstF5I GGATG 3 cut(s) 107, 362, 380
BstKTI GATC 5 cut(s) 58, 166, 181, 260, 349
BstMAI GTCTC 1 cut(s) 222
BstMBI GATC 5 cut(s) 55, 163, 178, 257, 346
BstNI CCWGG 1 cut(s) 23
BstSCI CCNGG 1 cut(s) 21
BstX2I RGATCY 2 cut(s) 55, 178
BstYI RGATCY 2 cut(s) 55, 178
BsuRI GGCC 2 cut(s) 110, 286
BtsCI GGATG 3 cut(s) 107, 362, 380
Cac8I GCNNGC 1 cut(s) 84
Cfr13I GGNCC 1 cut(s) 284
CviAII CATG 1 cut(s) 158
CviJI RGCY 7 cut(s) 21, 76, 82, 110, 133, 286, 388
CviKI_1 RGCY 7 cut(s) 21, 76, 82, 110, 133, 286, 388
DdeI CTNAG 1 cut(s) 137
DpnI GATC 5 cut(s) 57, 165, 180, 259, 348
DpnII GATC 5 cut(s) 55, 163, 178, 257, 346
Eam1104I CTCTTC 2 cut(s) 66, 257
EarI CTCTTC 2 cut(s) 66, 257
Eco130I CCWWGG 1 cut(s) 352
Eco57I CTGAAG 1 cut(s) 149
EcoRII CCWGG 1 cut(s) 21
EcoT14I CCWWGG 1 cut(s) 352
ErhI CCWWGG 1 cut(s) 352
FaeI CATG 1 cut(s) 161
FaiI YATR 4 cut(s) 9, 159, 233, 335
FatI CATG 1 cut(s) 157
FokI GGATG 3 cut(s) 114, 367, 369
FspBI CTAG 1 cut(s) 245
HaeIII GGCC 2 cut(s) 110, 286
Hin1II CATG 1 cut(s) 161
HindIII AAGCTT 1 cut(s) 386
HinfI GANTC 2 cut(s) 145, 241
HphI GGTGA 1 cut(s) 54
Hpy166II GTNNAC 1 cut(s) 220
Hpy188I TCNGA 2 cut(s) 150, 192
Hpy188III TCNNGA 3 cut(s) 33, 167, 245
Hpy8I GTNNAC 1 cut(s) 220
HpyAV CCTTC 4 cut(s) 121, 248, 298, 313
HpyF3I CTNAG 1 cut(s) 137
Hsp92II CATG 1 cut(s) 161
Kzo9I GATC 5 cut(s) 55, 163, 178, 257, 346
LguI GCTCTTC 1 cut(s) 66
LpnPI CCDG 3 cut(s) 8, 35, 46
LweI GCATC 1 cut(s) 92
MaeI CTAG 1 cut(s) 245
MalI GATC 5 cut(s) 57, 165, 180, 259, 348
MboI GATC 5 cut(s) 55, 163, 178, 257, 346
MboII GAAGA 4 cut(s) 83, 182, 274, 328
MflI RGATCY 2 cut(s) 55, 178
MluCI AATT 2 cut(s) 10, 288
MnlI CCTC 3 cut(s) 45, 146, 305
MseI TTAA 1 cut(s) 291
MslI CAYNNNNRTG 1 cut(s) 236
MspR9I CCNGG 1 cut(s) 23
Mva1269I GAATGC 1 cut(s) 370
MvaI CCWGG 1 cut(s) 23
NdeII GATC 5 cut(s) 55, 163, 178, 257, 346
NlaIII CATG 1 cut(s) 161
PciSI GCTCTTC 1 cut(s) 66
PctI GAATGC 1 cut(s) 370
PfeI GAWTC 2 cut(s) 145, 241
Psp6I CCWGG 1 cut(s) 21
PspGI CCWGG 1 cut(s) 21
PspPI GGNCC 1 cut(s) 284
PsuI RGATCY 2 cut(s) 55, 178
RseI CAYNNNNRTG 1 cut(s) 236
SapI GCTCTTC 1 cut(s) 66
SaqAI TTAA 1 cut(s) 291
Sau3AI GATC 5 cut(s) 55, 163, 178, 257, 346
Sau96I GGNCC 1 cut(s) 284
ScrFI CCNGG 1 cut(s) 23
SetI ASST 4 cut(s) 47, 78, 297, 390
SfaNI GCATC 1 cut(s) 92
SmiMI CAYNNNNRTG 1 cut(s) 236
Sse9I AATT 2 cut(s) 10, 288
SspMI CTAG 1 cut(s) 245
StyD4I CCNGG 1 cut(s) 21
StyI CCWWGG 1 cut(s) 352
TaqI TCGA 3 cut(s) 143, 166, 260
TasI AATT 2 cut(s) 10, 288
TfiI GAWTC 2 cut(s) 145, 241
Tru1I TTAA 1 cut(s) 291
Tru9I TTAA 1 cut(s) 291
TspDTI ATGAA 4 cut(s) 103, 146, 254, 317
XbaI TCTAGA 1 cut(s) 244
XspI CTAG 1 cut(s) 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.