RchiOBHm_Chr3g0495271

1-deoxy-D-xylulose 5-phosphate reductoisomerase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
44747579 .. 44748039
461 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45772

Sequence Viewer

Length: 147 bp
ATGATTATATGGTTGTTTGATGTGTGGGTTTGCTTTGAAGAGAAAAATTGCAGGACAGTGATTGGAAGAAGAATTCAGTGTTCAGCACAAGCACCACCTCCAGCTTGGCTAGGAAGTGCTTTTCCGGAGCCGGGCCAGAGGACTTGA

Protein Analysis

48

Amino Acids

5.51

Weight (kDa)

7.73

Isoelectric Point (pI)

59.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 124
AcsI RAATTY 1 cut(s) 72
AfiI CCNNNNNNNGG 1 cut(s) 131
AgsI TTSAA 1 cut(s) 38
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
Aor13HI TCCGGA 1 cut(s) 124
AoxI GGCC 1 cut(s) 133
ApoI RAATTY 1 cut(s) 72
AspS9I GGNCC 1 cut(s) 133
AsuC2I CCSGG 1 cut(s) 132
BcnI CCSGG 1 cut(s) 132
BfaI CTAG 1 cut(s) 110
Bme1390I CCNGG 1 cut(s) 132
BmgT120I GGNCC 1 cut(s) 133
BmiI GGNNCC 1 cut(s) 129
BmrFI CCNGG 1 cut(s) 132
BpmI CTGGAG 1 cut(s) 84
BpuMI CCSGG 1 cut(s) 132
BsaWI WCCGGW 1 cut(s) 124
Bsc4I CCNNNNNNNGG 1 cut(s) 131
BseAI TCCGGA 1 cut(s) 124
BseLI CCNNNNNNNGG 1 cut(s) 131
BshFI GGCC 1 cut(s) 135
BsiSI CCGG 2 cut(s) 125, 131
BslI CCNNNNNNNGG 1 cut(s) 131
BsnI GGCC 1 cut(s) 135
Bsp13I TCCGGA 1 cut(s) 124
BspANI GGCC 1 cut(s) 135
BspEI TCCGGA 1 cut(s) 124
BspLI GGNNCC 1 cut(s) 129
Bst4CI ACNGT 1 cut(s) 58
Bst6I CTCTTC 1 cut(s) 33
BstSCI CCNGG 1 cut(s) 130
BsuRI GGCC 1 cut(s) 135
BtsIMutI CAGTG 2 cut(s) 63, 83
Cfr13I GGNCC 1 cut(s) 133
CviJI RGCY 4 cut(s) 104, 109, 130, 135
CviKI_1 RGCY 4 cut(s) 104, 109, 130, 135
Eam1104I CTCTTC 1 cut(s) 33
EarI CTCTTC 1 cut(s) 33
EcoRI GAATTC 1 cut(s) 72
FaiI YATR 2 cut(s) 8, 10
FspBI CTAG 1 cut(s) 110
GsuI CTGGAG 1 cut(s) 84
HaeIII GGCC 1 cut(s) 135
HapII CCGG 2 cut(s) 125, 131
HpaII CCGG 2 cut(s) 125, 131
Hpy188III TCNNGA 1 cut(s) 125
HpyCH4III ACNGT 1 cut(s) 58
HpyCH4V TGCA 1 cut(s) 51
Kpn2I TCCGGA 1 cut(s) 124
LmnI GCTCC 1 cut(s) 127
LpnPI CCDG 3 cut(s) 37, 114, 138
MaeI CTAG 1 cut(s) 110
MboII GAAGA 3 cut(s) 50, 78, 81
MluCI AATT 2 cut(s) 46, 72
MnlI CCTC 2 cut(s) 108, 132
MroI TCCGGA 1 cut(s) 124
MspI CCGG 2 cut(s) 125, 131
MspR9I CCNGG 1 cut(s) 132
NciI CCSGG 1 cut(s) 132
NlaIV GGNNCC 1 cut(s) 129
PspN4I GGNNCC 1 cut(s) 129
PspPI GGNCC 1 cut(s) 133
Sau96I GGNCC 1 cut(s) 133
ScrFI CCNGG 1 cut(s) 132
SetI ASST 2 cut(s) 100, 106
SgeI CNNG 7 cut(s) 64, 101, 113, 117, 122, 137, 143
Sse9I AATT 2 cut(s) 46, 72
SspMI CTAG 1 cut(s) 110
StyD4I CCNGG 1 cut(s) 130
TaaI ACNGT 1 cut(s) 58
TasI AATT 2 cut(s) 46, 72
TscAI CASTG 2 cut(s) 63, 83
TspRI CASTG 2 cut(s) 63, 83
XapI RAATTY 1 cut(s) 72
XcmI CCANNNNNNNNNTGG 1 cut(s) 102
XspI CTAG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.