Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8111490.1

Orthogroup ID

OG0015745

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 568

Gene Structure 568 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8111490.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 273 bp

atctctttcttggattccaccaagtccactcacttgccaaagcttccaggtgggtttgctttgaggaggagagattgcagagcggtgatcggaagaagaattcagtgttcagcacaagcaccacctccagcttggccgggaagtgcttttccggagcccggccggaggacttgggatggtccaaagcctatttctgttgttggatctactggttccattggaacccaggtctttctttttagtatacgttttgagattaaagataaattgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000166 GO:0003674 GO:0003824 GO:0005488 GO:0006081 GO:0006082 GO:0006090 GO:0006629 GO:0006644 GO:0006720 GO:0006721 GO:0006793 GO:0006796 GO:0008150 GO:0008152 GO:0008299 GO:0008610 GO:0008654 GO:0009058 GO:0009240 GO:0009987 GO:0016114 GO:0016491 GO:0016614 GO:0016616 GO:0019288 GO:0019637 GO:0019682 GO:0019752 GO:0030145 GO:0030604 GO:0032787 GO:0036094 GO:0043167 GO:0043168 GO:0043169 GO:0043436 GO:0044237 GO:0044238 GO:0044249 GO:0044255 GO:0044281 GO:0046490 GO:0046872 GO:0046914 GO:0048037 GO:0050661 GO:0050662 GO:0051483 GO:0051484 GO:0055114 GO:0070402 GO:0071704 GO:0090407 GO:0097159 GO:1901135 GO:1901265 GO:1901363 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00900 ko01100 ko01110 ko01130 map00900 map01100 map01110 map01130

Pfam Domains

Protein Families

DXPR_C DXP_redisom_C DXP_reductoisom

Protein Analysis

90

Amino Acids

9.83

Weight (kDa)

10.87

Isoelectric Point (pI)

50.56

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015745)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0495271
rosa_laevigata	RLG00000029896 RLG00000035709
rosa_multiflora	Rmu_co8111490.1_g000001
rosa_roxburghii	Rroxscaffold_3G00229120 Rroxscaffold_3G00256330
rosa_samantha	Rh2AG271500 Rh2CG211000 Rh2DG214000 Rh4DG098900 Rh7AG293800 Rh7AG334500 Rh7AG373900 Rh7CG352200 Rh7CG392200 Rh7DG451900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	83
AccI	GTMKAC	1 cut(s)	244
AccIII	TCCGGA	1 cut(s)	151
AciI	CCGC	1 cut(s)	83
AclWI	GGATC	1 cut(s)	211
AcoI	YGGCCR	2 cut(s)	134, 160
AcsI	RAATTY	1 cut(s)	99
AfiI	CCNNNNNNNGG	2 cut(s)	158, 165
AjnI	CCWGG	2 cut(s)	46, 225
AjuI	GAANNNNNNNTTGG	2 cut(s)	175, 207
AluBI	AGCT	2 cut(s)	43, 131
AluI	AGCT	2 cut(s)	43, 131
AlwI	GGATC	1 cut(s)	211
Aor13HI	TCCGGA	1 cut(s)	151
AoxI	GGCC	2 cut(s)	134, 160
ApoI	RAATTY	1 cut(s)	99
AspS9I	GGNCC	1 cut(s)	179
AsuC2I	CCSGG	2 cut(s)	138, 159
AsuHPI	GGTGA	1 cut(s)	97
AvaII	GGWCC	1 cut(s)	179
BanII	GRGCYC	1 cut(s)	159
BccI	CCATC	1 cut(s)	170
BciT130I	CCWGG	2 cut(s)	48, 227
BcnI	CCSGG	2 cut(s)	138, 159
Bme1390I	CCNGG	4 cut(s)	48, 138, 159, 227
Bme18I	GGWCC	1 cut(s)	179
BmgT120I	GGNCC	1 cut(s)	179
BmiI	GGNNCC	3 cut(s)	156, 214, 223
BmrFI	CCNGG	4 cut(s)	48, 138, 159, 227
BpmI	CTGGAG	1 cut(s)	111
BpuMI	CCSGG	2 cut(s)	138, 159
BsaJI	CCNNGG	1 cut(s)	225
BsaWI	WCCGGW	1 cut(s)	151
Bsc4I	CCNNNNNNNGG	2 cut(s)	158, 165
Bse1I	ACTGG	1 cut(s)	214
BseAI	TCCGGA	1 cut(s)	151
BseBI	CCWGG	2 cut(s)	48, 227
BseDI	CCNNGG	1 cut(s)	225
BseGI	GGATG	1 cut(s)	181
BseLI	CCNNNNNNNGG	2 cut(s)	158, 165
BseNI	ACTGG	1 cut(s)	214
BseRI	GAGGAG	2 cut(s)	79, 82
BseX3I	CGGCCG	1 cut(s)	160
Bsh1285I	CGRYCG	1 cut(s)	163
BshFI	GGCC	2 cut(s)	136, 162
BsiEI	CGRYCG	1 cut(s)	163
BsiSI	CCGG	4 cut(s)	137, 152, 159, 163
BslI	CCNNNNNNNGG	2 cut(s)	158, 165
BsnI	GGCC	2 cut(s)	136, 162
Bsp1286I	GDGCHC	1 cut(s)	159
Bsp13I	TCCGGA	1 cut(s)	151
Bsp143I	GATC	2 cut(s)	87, 203
BspACI	CCGC	1 cut(s)	83
BspANI	GGCC	2 cut(s)	136, 162
BspEI	TCCGGA	1 cut(s)	151
BspLI	GGNNCC	3 cut(s)	156, 214, 223
BspPI	GGATC	1 cut(s)	211
BsrBI	CCGCTC	1 cut(s)	83
BsrI	ACTGG	1 cut(s)	214
BssECI	CCNNGG	1 cut(s)	225
BssMI	GATC	2 cut(s)	87, 203
BssNAI	GTATAC	1 cut(s)	245
Bst1107I	GTATAC	1 cut(s)	245
Bst2UI	CCWGG	2 cut(s)	48, 227
BstF5I	GGATG	1 cut(s)	181
BstKTI	GATC	2 cut(s)	90, 206
BstMBI	GATC	2 cut(s)	87, 203
BstMCI	CGRYCG	1 cut(s)	163
BstNI	CCWGG	2 cut(s)	48, 227
BstSCI	CCNGG	4 cut(s)	46, 136, 157, 225
BstX2I	RGATCY	1 cut(s)	203
BstYI	RGATCY	1 cut(s)	203
BstZ17I	GTATAC	1 cut(s)	245
BstZI	CGGCCG	1 cut(s)	160
BsuRI	GGCC	2 cut(s)	136, 162
BtsCI	GGATG	1 cut(s)	181
BtsIMutI	CAGTG	1 cut(s)	110
Cfr13I	GGNCC	1 cut(s)	179
CviJI	RGCY	6 cut(s)	43, 131, 136, 157, 162, 187
CviKI_1	RGCY	6 cut(s)	43, 131, 136, 157, 162, 187
DpnI	GATC	2 cut(s)	89, 205
DpnII	GATC	2 cut(s)	87, 203
EaeI	YGGCCR	2 cut(s)	134, 160
EagI	CGGCCG	1 cut(s)	160
EclXI	CGGCCG	1 cut(s)	160
Eco24I	GRGCYC	1 cut(s)	159
Eco47I	GGWCC	1 cut(s)	179
Eco52I	CGGCCG	1 cut(s)	160
EcoRI	GAATTC	1 cut(s)	99
EcoRII	CCWGG	2 cut(s)	46, 225
EcoT38I	GRGCYC	1 cut(s)	159
FaiI	YATR	1 cut(s)	245
FblI	GTMKAC	1 cut(s)	244
FokI	GGATG	1 cut(s)	188
FriOI	GRGCYC	1 cut(s)	159
GsuI	CTGGAG	1 cut(s)	111
HaeIII	GGCC	2 cut(s)	136, 162
HapII	CCGG	4 cut(s)	137, 152, 159, 163
HindIII	AAGCTT	1 cut(s)	41
HinfI	GANTC	1 cut(s)	14
HpaII	CCGG	4 cut(s)	137, 152, 159, 163
HphI	GGTGA	1 cut(s)	97
Hpy166II	GTNNAC	2 cut(s)	27, 245
Hpy188I	TCNGA	1 cut(s)	92
Hpy188III	TCNNGA	1 cut(s)	152
Hpy8I	GTNNAC	2 cut(s)	27, 245
HpyCH4IV	ACGT	1 cut(s)	247
HpyCH4V	TGCA	1 cut(s)	78
HpySE526I	ACGT	1 cut(s)	247
Kpn2I	TCCGGA	1 cut(s)	151
Kzo9I	GATC	2 cut(s)	87, 203
LmnI	GCTCC	1 cut(s)	154
MaeII	ACGT	1 cut(s)	247
MalI	GATC	2 cut(s)	89, 205
MbiI	CCGCTC	1 cut(s)	83
MboI	GATC	2 cut(s)	87, 203
MboII	GAAGA	2 cut(s)	105, 108
MflI	RGATCY	1 cut(s)	203
MhlI	GDGCHC	1 cut(s)	159
MluCI	AATT	2 cut(s)	99, 266
MmeI	TCCRAC	1 cut(s)	181
MnlI	CCTC	4 cut(s)	57, 60, 135, 159
MroI	TCCGGA	1 cut(s)	151
MseI	TTAA	1 cut(s)	258
MspI	CCGG	4 cut(s)	137, 152, 159, 163
MspR9I	CCNGG	4 cut(s)	48, 138, 159, 227
MvaI	CCWGG	2 cut(s)	48, 227
NciI	CCSGG	2 cut(s)	138, 159
NdeII	GATC	2 cut(s)	87, 203
NlaIV	GGNNCC	3 cut(s)	156, 214, 223
PfeI	GAWTC	1 cut(s)	14
Psp6I	CCWGG	2 cut(s)	46, 225
PspGI	CCWGG	2 cut(s)	46, 225
PspN4I	GGNNCC	3 cut(s)	156, 214, 223
PspPI	GGNCC	1 cut(s)	179
PsuI	RGATCY	1 cut(s)	203
SaqAI	TTAA	1 cut(s)	258
Sau3AI	GATC	2 cut(s)	87, 203
Sau96I	GGNCC	1 cut(s)	179
ScrFI	CCNGG	4 cut(s)	48, 138, 159, 227
SduI	GDGCHC	1 cut(s)	159
SetI	ASST	6 cut(s)	45, 52, 127, 133, 231, 250
SinI	GGWCC	1 cut(s)	179
Sse9I	AATT	2 cut(s)	99, 266
SsiI	CCGC	1 cut(s)	83
StyD4I	CCNGG	4 cut(s)	46, 136, 157, 225
TaiI	ACGT	1 cut(s)	250
TasI	AATT	2 cut(s)	99, 266
TfiI	GAWTC	1 cut(s)	14
Tru1I	TTAA	1 cut(s)	258
Tru9I	TTAA	1 cut(s)	258
TscAI	CASTG	1 cut(s)	110
TspRI	CASTG	1 cut(s)	110
VpaK11BI	GGWCC	1 cut(s)	179
XapI	RAATTY	1 cut(s)	99
XcmI	CCANNNNNNNNNTGG	1 cut(s)	129
XmiI	GTMKAC	1 cut(s)	244

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.