RLG00000035709

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Forward (+)
70659230 .. 70660290
1061 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000035709

Sequence Viewer

Length: 321 bp
ATGCGGCAAATTAGGCACAAGCTTTCTATTCACGACAACGAGATGGGGATGCCTAATTTTGAGAATGGCATGGTTGATGATCGGGTGAGGAGAGGAAGAGAGCAGCATGATTATGGAGAGGATGATGCACAATCTGAAGATGAAGATTACACACCACAGTTTGAGGATGATGATTATGGAGATTATGGTTGGGATGATGATTGGCTAGTGGTTATAGAAGAAGAATTTGATGTCTTTGGTGACAATATTGGACTAAATACACAAGGGTCAGCTGGTATTGGAAGTAGTGTGAAGCAAAACATTGTGATTGAGGACAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

12.25

Weight (kDa)

4.05

Isoelectric Point (pI)

60.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 4
AcsI RAATTY 1 cut(s) 224
AcuI CTGAAG 1 cut(s) 156
AluBI AGCT 2 cut(s) 22, 272
AluI AGCT 2 cut(s) 22, 272
ApeKI GCWGC 1 cut(s) 103
ApoI RAATTY 1 cut(s) 224
AsuHPI GGTGA 2 cut(s) 97, 251
BbvI GCAGC 1 cut(s) 115
BccI CCATC 1 cut(s) 37
BfaI CTAG 1 cut(s) 206
BisI GCNGC 2 cut(s) 5, 104
BlsI GCNGC 2 cut(s) 6, 105
BmsI GCATC 2 cut(s) 39, 115
BseGI GGATG 4 cut(s) 54, 127, 172, 199
BseRI GAGGAG 1 cut(s) 103
BseXI GCAGC 1 cut(s) 115
Bsp143I GATC 1 cut(s) 79
BspACI CCGC 1 cut(s) 4
BssMI GATC 1 cut(s) 79
Bst4CI ACNGT 1 cut(s) 159
Bst6I CTCTTC 1 cut(s) 91
BstF5I GGATG 4 cut(s) 54, 127, 172, 199
BstKTI GATC 1 cut(s) 82
BstMBI GATC 1 cut(s) 79
BstMWI GCNNNNNNNGC 1 cut(s) 13
BstV1I GCAGC 1 cut(s) 115
BtsCI GGATG 4 cut(s) 54, 127, 172, 199
CviAII CATG 2 cut(s) 70, 107
CviJI RGCY 3 cut(s) 22, 205, 272
CviKI_1 RGCY 3 cut(s) 22, 205, 272
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
Eam1104I CTCTTC 1 cut(s) 91
EarI CTCTTC 1 cut(s) 91
Eco57I CTGAAG 1 cut(s) 156
FaeI CATG 2 cut(s) 73, 110
FaiI YATR 6 cut(s) 71, 108, 114, 177, 186, 215
FatI CATG 2 cut(s) 69, 106
Fnu4HI GCNGC 2 cut(s) 5, 104
FokI GGATG 4 cut(s) 61, 134, 179, 206
Fsp4HI GCNGC 2 cut(s) 5, 104
FspBI CTAG 1 cut(s) 206
GluI GCNGC 2 cut(s) 5, 104
Hin1II CATG 2 cut(s) 73, 110
HindIII AAGCTT 1 cut(s) 20
HphI GGTGA 2 cut(s) 97, 251
Hpy188I TCNGA 1 cut(s) 136
Hpy188III TCNNGA 1 cut(s) 32
HpyCH4III ACNGT 1 cut(s) 159
HpyCH4V TGCA 1 cut(s) 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 13
Hsp92II CATG 2 cut(s) 73, 110
Kzo9I GATC 1 cut(s) 79
LpnPI CCDG 1 cut(s) 258
Lsp1109I GCAGC 1 cut(s) 115
LweI GCATC 2 cut(s) 39, 115
MaeI CTAG 1 cut(s) 206
MaeIII GTNAC 1 cut(s) 239
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MboII GAAGA 5 cut(s) 108, 149, 155, 230, 233
MluCI AATT 4 cut(s) 9, 55, 224, 316
MnlI CCTC 5 cut(s) 81, 86, 112, 157, 304
MslI CAYNNNNRTG 1 cut(s) 111
MspA1I CMGCKG 1 cut(s) 272
MwoI GCNNNNNNNGC 1 cut(s) 13
NdeII GATC 1 cut(s) 79
NlaIII CATG 2 cut(s) 73, 110
NmuCI GTSAC 1 cut(s) 239
PkrI GCNGC 2 cut(s) 6, 105
PvuII CAGCTG 1 cut(s) 272
RseI CAYNNNNRTG 1 cut(s) 111
SatI GCNGC 2 cut(s) 5, 104
Sau3AI GATC 1 cut(s) 79
SetI ASST 2 cut(s) 24, 274
SfaNI GCATC 2 cut(s) 39, 115
SgeI CNNG 9 cut(s) 31, 44, 52, 82, 95, 119, 218, 275, 285
SmiMI CAYNNNNRTG 1 cut(s) 111
Sse9I AATT 4 cut(s) 9, 55, 224, 316
SsiI CCGC 1 cut(s) 4
SspI AATATT 1 cut(s) 247
SspMI CTAG 1 cut(s) 206
TaaI ACNGT 1 cut(s) 159
TasI AATT 4 cut(s) 9, 55, 224, 316
TauI GCSGC 1 cut(s) 7
TseFI GTSAC 1 cut(s) 239
TseI GCWGC 1 cut(s) 103
Tsp45I GTSAC 1 cut(s) 239
TspDTI ATGAA 1 cut(s) 156
XapI RAATTY 1 cut(s) 224
XspI CTAG 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.