Rh2AG271500

1-deoxy-D-xylulose 5-phosphate reductoisomerase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
32333572 .. 32335648
2077 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG271500.1

Sequence Viewer

Length: 168 bp
ATGGATGAATGGAGACCCCGAAATGGGGGGGATACAGTTGCTGATGAAATTCCTAAATATGAGAAAAATTGCAGGACAATGATTGGAAGAAGAATTCAATGTTCAGCACAAGCACCACCTCCAGCTTGGCTAGGAAGTGCTTTTCCGGAGCCGAGCCAGAGGACTTGA

Protein Analysis

55

Amino Acids

6.22

Weight (kDa)

7.8

Isoelectric Point (pI)

50.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 145
AcsI RAATTY 2 cut(s) 48, 93
AfiI CCNNNNNNNGG 3 cut(s) 23, 24, 25
AgsI TTSAA 1 cut(s) 98
AluBI AGCT 1 cut(s) 125
AluI AGCT 1 cut(s) 125
Alw26I GTCTC 1 cut(s) 7
AlwNI CAGNNNCTG 1 cut(s) 41
Aor13HI TCCGGA 1 cut(s) 145
ApoI RAATTY 2 cut(s) 48, 93
BciVI GTATCC 1 cut(s) 25
BcoDI GTCTC 1 cut(s) 7
BfaI CTAG 1 cut(s) 131
BfuI GTATCC 1 cut(s) 25
BmiI GGNNCC 1 cut(s) 150
BpmI CTGGAG 1 cut(s) 105
BsaI GGTCTC 1 cut(s) 7
BsaWI WCCGGW 1 cut(s) 145
Bsc4I CCNNNNNNNGG 3 cut(s) 23, 24, 25
BseAI TCCGGA 1 cut(s) 145
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 3 cut(s) 23, 24, 25
BsiSI CCGG 1 cut(s) 146
BslI CCNNNNNNNGG 3 cut(s) 23, 24, 25
BsmAI GTCTC 1 cut(s) 7
Bso31I GGTCTC 1 cut(s) 7
Bsp13I TCCGGA 1 cut(s) 145
BspEI TCCGGA 1 cut(s) 145
BspLI GGNNCC 1 cut(s) 150
BspTNI GGTCTC 1 cut(s) 7
Bst4CI ACNGT 1 cut(s) 37
BstF5I GGATG 1 cut(s) 10
BstMAI GTCTC 1 cut(s) 7
BsuI GTATCC 1 cut(s) 25
BtsCI GGATG 1 cut(s) 10
CaiI CAGNNNCTG 1 cut(s) 41
CviJI RGCY 4 cut(s) 125, 130, 151, 156
CviKI_1 RGCY 4 cut(s) 125, 130, 151, 156
Eco31I GGTCTC 1 cut(s) 7
EcoRI GAATTC 1 cut(s) 93
FaiI YATR 1 cut(s) 60
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 131
GsuI CTGGAG 1 cut(s) 105
HapII CCGG 1 cut(s) 146
HpaII CCGG 1 cut(s) 146
Hpy188III TCNNGA 1 cut(s) 146
HpyCH4III ACNGT 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 72
Kpn2I TCCGGA 1 cut(s) 145
LmnI GCTCC 1 cut(s) 148
LpnPI CCDG 3 cut(s) 58, 135, 159
MaeI CTAG 1 cut(s) 131
MboII GAAGA 2 cut(s) 99, 102
MluCI AATT 3 cut(s) 48, 67, 93
MnlI CCTC 2 cut(s) 129, 153
MroI TCCGGA 1 cut(s) 145
MspI CCGG 1 cut(s) 146
NlaIV GGNNCC 1 cut(s) 150
PspN4I GGNNCC 1 cut(s) 150
PstNI CAGNNNCTG 1 cut(s) 41
SetI ASST 2 cut(s) 121, 127
SgeI CNNG 7 cut(s) 30, 85, 122, 134, 138, 143, 158
Sse9I AATT 3 cut(s) 48, 67, 93
SspMI CTAG 1 cut(s) 131
TaaI ACNGT 1 cut(s) 37
TasI AATT 3 cut(s) 48, 67, 93
TspDTI ATGAA 2 cut(s) 21, 60
XapI RAATTY 2 cut(s) 48, 93
XcmI CCANNNNNNNNNTGG 1 cut(s) 123
XspI CTAG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.