Rroxscaffold_3G00229120

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
13634529 .. 13636153
1625 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00229120.1

Sequence Viewer

Length: 186 bp
ATGGATGAATGGAGACCCCGAAATGGAGGGGATATAGTTGATGACAAAATTTCTAAATATGGAAGAGTGCAGGTTGATTATAAGGAGGATGGGGCACAATCTGGAGATGATGATTCTGCAGATGAAGATTATAGGCCACATTTTGAGGATGATGAATATGGGGATTATGGTTGGGATGACGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

7.12

Weight (kDa)

4.05

Isoelectric Point (pI)

14.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 81
Acc36I ACCTGC 1 cut(s) 61
AcsI RAATTY 1 cut(s) 48
AfiI CCNNNNNNNGG 1 cut(s) 23
Alw26I GTCTC 1 cut(s) 7
AoxI GGCC 1 cut(s) 134
ApoI RAATTY 1 cut(s) 48
BaeGI GKGCMC 1 cut(s) 97
BccI CCATC 1 cut(s) 83
BcoDI GTCTC 1 cut(s) 7
BfmI CTRYAG 1 cut(s) 117
BfuAI ACCTGC 1 cut(s) 61
BpmI CTGGAG 1 cut(s) 123
BsaI GGTCTC 1 cut(s) 7
Bsc4I CCNNNNNNNGG 1 cut(s) 23
BseGI GGATG 4 cut(s) 10, 94, 154, 181
BseLI CCNNNNNNNGG 1 cut(s) 23
BseSI GKGCMC 1 cut(s) 97
BsgI GTGCAG 1 cut(s) 89
BshFI GGCC 1 cut(s) 136
BslI CCNNNNNNNGG 1 cut(s) 23
BsmAI GTCTC 1 cut(s) 7
BsnI GGCC 1 cut(s) 136
Bso31I GGTCTC 1 cut(s) 7
Bsp1286I GDGCHC 1 cut(s) 97
BspANI GGCC 1 cut(s) 136
BspMAI CTGCAG 1 cut(s) 121
BspMI ACCTGC 1 cut(s) 61
BspTNI GGTCTC 1 cut(s) 7
Bst6I CTCTTC 1 cut(s) 58
BstF5I GGATG 4 cut(s) 10, 94, 154, 181
BstMAI GTCTC 1 cut(s) 7
BstSFI CTRYAG 1 cut(s) 117
BstSLI GKGCMC 1 cut(s) 97
BsuRI GGCC 1 cut(s) 136
BtsCI GGATG 4 cut(s) 10, 94, 154, 181
BveI ACCTGC 1 cut(s) 61
CviJI RGCY 1 cut(s) 136
CviKI_1 RGCY 1 cut(s) 136
Eam1104I CTCTTC 1 cut(s) 58
EarI CTCTTC 1 cut(s) 58
Eco31I GGTCTC 1 cut(s) 7
FaiI YATR 6 cut(s) 35, 60, 81, 132, 159, 168
FokI GGATG 3 cut(s) 17, 101, 161
GsuI CTGGAG 1 cut(s) 123
HaeIII GGCC 1 cut(s) 136
HinfI GANTC 1 cut(s) 113
Hpy188III TCNNGA 1 cut(s) 102
HpyCH4V TGCA 2 cut(s) 70, 119
LpnPI CCDG 2 cut(s) 56, 87
MboII GAAGA 2 cut(s) 75, 137
MhlI GDGCHC 1 cut(s) 97
MluCI AATT 1 cut(s) 48
MnlI CCTC 3 cut(s) 20, 79, 139
PfeI GAWTC 1 cut(s) 113
PsiI TTATAA 1 cut(s) 81
PstI CTGCAG 1 cut(s) 121
SduI GDGCHC 1 cut(s) 97
SetI ASST 1 cut(s) 75
SfcI CTRYAG 1 cut(s) 117
SgeI CNNG 3 cut(s) 30, 83, 114
Sse9I AATT 1 cut(s) 48
TasI AATT 1 cut(s) 48
TfiI GAWTC 1 cut(s) 113
TspDTI ATGAA 3 cut(s) 21, 138, 168
XapI RAATTY 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.