Rh4DG098900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
14989601 .. 14996713
7113 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG098900.1

Sequence Viewer

Length: 453 bp
ATGGATGAATGGAGACCCCGAAATGGGGGGGATACAGTTGCTGATGAAATTCCTAAATATGATGAAGATTATAGGCCACATTTTGAGGATGATGAATATGGAGATTATGGTTGGGATGATGATTGGCTGGAAGATATGGAAGGTGAATTTGATGTCTTTGGTGAGAGTATTGACCCAAGTACACAAGTAAAAGCTGCTGTTGGAAGTACTGTTGAGGAAGAGTTTGTGGTCGAGGACAATGAAGATATGTATAAAGCAGTTGATTCTGATGAGGAAAAAAAAAGGGATGAGAAGAAGGCTGCCACAGCTAGAGCTACTCCCACAAATGCAAGAGCTACTCCCACAAATGCAAGAGCTGTTCCTGCTTCAAGCTCGAAAGGAACTGCTGCAAAAGGTACAGCCTCTGCAACACCCACTAGATCATCAAAGAGGCTTAGAGAAAGTGGAAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

150

Amino Acids

16.65

Weight (kDa)

4.42

Isoelectric Point (pI)

38.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 48, 146
AfaI GTAC 3 cut(s) 181, 208, 397
AfiI CCNNNNNNNGG 3 cut(s) 23, 24, 25
AgsI TTSAA 1 cut(s) 369
AluBI AGCT 6 cut(s) 194, 308, 314, 335, 356, 372
AluI AGCT 6 cut(s) 194, 308, 314, 335, 356, 372
Alw26I GTCTC 1 cut(s) 7
AlwNI CAGNNNCTG 2 cut(s) 41, 404
AoxI GGCC 1 cut(s) 74
ApeKI GCWGC 3 cut(s) 194, 299, 386
ApoI RAATTY 2 cut(s) 48, 146
AsuHPI GGTGA 2 cut(s) 155, 173
BbvI GCAGC 3 cut(s) 181, 286, 373
BciVI GTATCC 1 cut(s) 25
BcoDI GTCTC 1 cut(s) 7
BfaI CTAG 2 cut(s) 309, 417
BfuI GTATCC 1 cut(s) 25
BisI GCNGC 3 cut(s) 195, 300, 387
BlsI GCNGC 3 cut(s) 196, 301, 388
BmcAI AGTACT 1 cut(s) 208
BsaI GGTCTC 1 cut(s) 7
Bsc4I CCNNNNNNNGG 3 cut(s) 23, 24, 25
BseGI GGATG 4 cut(s) 10, 94, 121, 292
BseLI CCNNNNNNNGG 3 cut(s) 23, 24, 25
BseXI GCAGC 3 cut(s) 181, 286, 373
BshFI GGCC 1 cut(s) 76
BslI CCNNNNNNNGG 3 cut(s) 23, 24, 25
BsmAI GTCTC 1 cut(s) 7
BsnI GGCC 1 cut(s) 76
Bso31I GGTCTC 1 cut(s) 7
Bsp143I GATC 1 cut(s) 419
BspANI GGCC 1 cut(s) 76
BspTNI GGTCTC 1 cut(s) 7
BssMI GATC 1 cut(s) 419
Bst4CI ACNGT 2 cut(s) 37, 211
Bst6I CTCTTC 1 cut(s) 213
BstDEI CTNAG 1 cut(s) 434
BstF5I GGATG 4 cut(s) 10, 94, 121, 292
BstKTI GATC 1 cut(s) 422
BstMAI GTCTC 1 cut(s) 7
BstMBI GATC 1 cut(s) 419
BstMWI GCNNNNNNNGC 2 cut(s) 305, 362
BstV1I GCAGC 3 cut(s) 181, 286, 373
BsuI GTATCC 1 cut(s) 25
BsuRI GGCC 1 cut(s) 76
BtsCI GGATG 4 cut(s) 10, 94, 121, 292
CaiI CAGNNNCTG 2 cut(s) 41, 404
Csp6I GTAC 3 cut(s) 180, 207, 396
CviQI GTAC 3 cut(s) 180, 207, 396
DdeI CTNAG 1 cut(s) 434
DpnI GATC 1 cut(s) 421
DpnII GATC 1 cut(s) 419
Eam1104I CTCTTC 1 cut(s) 213
EarI CTCTTC 1 cut(s) 213
Eco31I GGTCTC 1 cut(s) 7
FaiI YATR 7 cut(s) 60, 72, 99, 108, 137, 248, 252
Fnu4HI GCNGC 3 cut(s) 195, 300, 387
FokI GGATG 4 cut(s) 17, 101, 128, 299
Fsp4HI GCNGC 3 cut(s) 195, 300, 387
FspBI CTAG 2 cut(s) 309, 417
GluI GCNGC 3 cut(s) 195, 300, 387
HaeIII GGCC 1 cut(s) 76
HinfI GANTC 1 cut(s) 263
HphI GGTGA 2 cut(s) 155, 173
Hpy166II GTNNAC 1 cut(s) 182
Hpy188I TCNGA 1 cut(s) 268
Hpy8I GTNNAC 1 cut(s) 182
HpyAV CCTTC 2 cut(s) 134, 289
HpyCH4III ACNGT 2 cut(s) 37, 211
HpyCH4V TGCA 4 cut(s) 329, 350, 389, 407
HpyF10VI GCNNNNNNNGC 2 cut(s) 305, 362
HpyF3I CTNAG 1 cut(s) 434
Kzo9I GATC 1 cut(s) 419
LpnPI CCDG 2 cut(s) 113, 375
Lsp1109I GCAGC 3 cut(s) 181, 286, 373
MaeI CTAG 2 cut(s) 309, 417
MalI GATC 1 cut(s) 421
MboI GATC 1 cut(s) 419
MboII GAAGA 5 cut(s) 77, 143, 230, 254, 304
MluCI AATT 2 cut(s) 48, 146
MmeI TCCRAC 1 cut(s) 181
MnlI CCTC 6 cut(s) 79, 208, 226, 265, 412, 423
MwoI GCNNNNNNNGC 2 cut(s) 305, 362
NdeII GATC 1 cut(s) 419
PfeI GAWTC 1 cut(s) 263
PkrI GCNGC 3 cut(s) 196, 301, 388
PstNI CAGNNNCTG 2 cut(s) 41, 404
RsaI GTAC 3 cut(s) 181, 208, 397
RsaNI GTAC 3 cut(s) 180, 207, 396
SatI GCNGC 3 cut(s) 195, 300, 387
Sau3AI GATC 1 cut(s) 419
ScaI AGTACT 1 cut(s) 208
SetI ASST 8 cut(s) 145, 196, 310, 316, 337, 358, 374, 397
Sse9I AATT 2 cut(s) 48, 146
SspMI CTAG 2 cut(s) 309, 417
TaaI ACNGT 2 cut(s) 37, 211
TaqI TCGA 2 cut(s) 231, 374
TasI AATT 2 cut(s) 48, 146
TatI WGTACW 2 cut(s) 179, 206
TfiI GAWTC 1 cut(s) 263
TseI GCWGC 3 cut(s) 194, 299, 386
TspDTI ATGAA 5 cut(s) 21, 60, 78, 108, 255
XapI RAATTY 2 cut(s) 48, 146
XspI CTAG 2 cut(s) 309, 417
ZrmI AGTACT 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.