RchiOBHm_Chr4g0388181

Sterol 3-beta-glucosyltransferase UGT80A2-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
3342946 .. 3343747
802 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36143

Sequence Viewer

Length: 324 bp
ATGGGTTCCTACTATAAGGAGCATAGAATTCTTCCCCACTTCCAGAACTCAGCTTGCTGTATATCTATTCAATATAACTTTGCAATGAGGCTTGGTGGCTTACGGGATAAGGATGGTTTTATGTTATCTACTTTCAACTCCATCAGCTTTTTGTTTGAAACTATATCTAGTCCTCACACTACTTTCAACCCCAGCCATTTTTCTTTCTTTTATTGTGCCTTGTATCAGCCTCTTCAAGAACTAGAGAAGATGACCAATATTATTCTTCAAGCTCTGAAAATTACTGGACAAAGAGGCATTATCAACAAAGGCTGGGGTTGGTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

12.4

Weight (kDa)

8.88

Isoelectric Point (pI)

43.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 27
AgsI TTSAA 6 cut(s) 71, 136, 158, 187, 236, 269
AluBI AGCT 3 cut(s) 53, 147, 272
AluI AGCT 3 cut(s) 53, 147, 272
ApoI RAATTY 1 cut(s) 27
BccI CCATC 2 cut(s) 107, 149
BfaI CTAG 2 cut(s) 168, 242
BmiI GGNNCC 1 cut(s) 7
Bse1I ACTGG 1 cut(s) 289
Bse3DI GCAATG 1 cut(s) 90
BseGI GGATG 1 cut(s) 118
BseMI GCAATG 1 cut(s) 90
BseMII CTCAG 1 cut(s) 63
BseNI ACTGG 1 cut(s) 289
BseYI CCCAGC 2 cut(s) 191, 312
BspCNI CTCAG 1 cut(s) 62
BspLI GGNNCC 1 cut(s) 7
BsrDI GCAATG 1 cut(s) 90
BsrI ACTGG 1 cut(s) 289
Bst6I CTCTTC 1 cut(s) 237
BstC8I GCNNGC 1 cut(s) 55
BstDEI CTNAG 1 cut(s) 49
BstF5I GGATG 1 cut(s) 118
BtsCI GGATG 1 cut(s) 118
Cac8I GCNNGC 1 cut(s) 55
CviJI RGCY 8 cut(s) 53, 91, 99, 147, 195, 229, 272, 312
CviKI_1 RGCY 8 cut(s) 53, 91, 99, 147, 195, 229, 272, 312
DdeI CTNAG 1 cut(s) 49
Eam1104I CTCTTC 1 cut(s) 237
EarI CTCTTC 1 cut(s) 237
EcoRI GAATTC 1 cut(s) 27
FaiI YATR 6 cut(s) 15, 24, 62, 75, 122, 164
FokI GGATG 1 cut(s) 125
FspBI CTAG 2 cut(s) 168, 242
GsaI CCCAGC 2 cut(s) 195, 316
Hpy188I TCNGA 1 cut(s) 276
Hpy188III TCNNGA 2 cut(s) 43, 236
HpyCH4V TGCA 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 49
LmnI GCTCC 1 cut(s) 19
LpnPI CCDG 4 cut(s) 56, 205, 270, 298
MaeI CTAG 2 cut(s) 168, 242
MboII GAAGA 4 cut(s) 23, 224, 257, 259
MluCI AATT 2 cut(s) 27, 279
MnlI CCTC 4 cut(s) 81, 183, 240, 287
NlaIV GGNNCC 1 cut(s) 7
PspFI CCCAGC 2 cut(s) 191, 312
PspN4I GGNNCC 1 cut(s) 7
SetI ASST 3 cut(s) 55, 149, 274
Sse9I AATT 2 cut(s) 27, 279
SspI AATATT 1 cut(s) 259
SspMI CTAG 2 cut(s) 168, 242
TasI AATT 2 cut(s) 27, 279
XapI RAATTY 1 cut(s) 27
XspI CTAG 2 cut(s) 168, 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.