Rh6AG192900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
34509773 .. 34511407
1635 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG192900.1

Sequence Viewer

Length: 372 bp
ATGTTCAAATTTTCTTTTCGAAGGTACGATTCGTCTTTGAAATCGGTGAAGGAGCTTAACCAACCCCCTGGATTCGAATTGCGGGGTGTTCGTGAATCGAAGAAGGAGATGATAGGTGGAAGGATGGGTTCCTACTATAAGGAGCATAGAATTCTTCCCCACTTCCAGAACTCAGCTTGCTGTATATCTATTCAATATAACTTTGCAATGAGGCTTGGTGGCTTACGGGATAAGGATGGTTTTATGTTATCTACTTTCAACTCCATCAGCTTTTTGTTTGAAGCTAGTACGTATCTAGTCCTCACACTACTTTCAACCCCAGCCATTTTTCTTTCTTTTATTGTGCCTTGTATCAGCCTCTTCAAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

123

Amino Acids

14.16

Weight (kDa)

9.58

Isoelectric Point (pI)

30.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 82
AcsI RAATTY 2 cut(s) 8, 150
AfaI GTAC 2 cut(s) 26, 289
AgsI TTSAA 7 cut(s) 7, 40, 194, 259, 281, 315, 364
AjnI CCWGG 1 cut(s) 67
AluBI AGCT 4 cut(s) 55, 176, 270, 284
AluI AGCT 4 cut(s) 55, 176, 270, 284
ApoI RAATTY 2 cut(s) 8, 150
AsuHPI GGTGA 1 cut(s) 58
AsuII TTCGAA 2 cut(s) 19, 75
BccI CCATC 3 cut(s) 118, 230, 272
BciT130I CCWGG 1 cut(s) 69
BfaI CTAG 3 cut(s) 285, 296, 370
Bme1390I CCNGG 1 cut(s) 69
BmiI GGNNCC 1 cut(s) 130
BmrFI CCNGG 1 cut(s) 69
Bpu14I TTCGAA 2 cut(s) 19, 75
BsaAI YACGTR 1 cut(s) 291
BsaJI CCNNGG 1 cut(s) 67
Bse3DI GCAATG 1 cut(s) 213
BseBI CCWGG 1 cut(s) 69
BseDI CCNNGG 1 cut(s) 67
BseGI GGATG 2 cut(s) 129, 241
BseMI GCAATG 1 cut(s) 213
BseMII CTCAG 1 cut(s) 186
BseYI CCCAGC 1 cut(s) 319
Bsp119I TTCGAA 2 cut(s) 19, 75
BspACI CCGC 1 cut(s) 82
BspCNI CTCAG 1 cut(s) 185
BspLI GGNNCC 1 cut(s) 130
BspT104I TTCGAA 2 cut(s) 19, 75
BsrDI GCAATG 1 cut(s) 213
BssECI CCNNGG 1 cut(s) 67
Bst2UI CCWGG 1 cut(s) 69
Bst6I CTCTTC 1 cut(s) 365
BstBAI YACGTR 1 cut(s) 291
BstBI TTCGAA 2 cut(s) 19, 75
BstC8I GCNNGC 1 cut(s) 178
BstDEI CTNAG 1 cut(s) 172
BstF5I GGATG 2 cut(s) 129, 241
BstNI CCWGG 1 cut(s) 69
BstSCI CCNGG 1 cut(s) 67
BstSNI TACGTA 1 cut(s) 291
BstXI CCANNNNNNTGG 1 cut(s) 68
BtsCI GGATG 2 cut(s) 129, 241
Cac8I GCNNGC 1 cut(s) 178
Csp6I GTAC 2 cut(s) 25, 288
CviJI RGCY 8 cut(s) 55, 176, 214, 222, 270, 284, 323, 357
CviKI_1 RGCY 8 cut(s) 55, 176, 214, 222, 270, 284, 323, 357
CviQI GTAC 2 cut(s) 25, 288
DdeI CTNAG 1 cut(s) 172
Eam1104I CTCTTC 1 cut(s) 365
EarI CTCTTC 1 cut(s) 365
Eco105I TACGTA 1 cut(s) 291
EcoRI GAATTC 1 cut(s) 150
EcoRII CCWGG 1 cut(s) 67
FaiI YATR 5 cut(s) 138, 147, 185, 198, 245
FauI CCCGC 1 cut(s) 75
FokI GGATG 2 cut(s) 136, 248
FspBI CTAG 3 cut(s) 285, 296, 370
GsaI CCCAGC 1 cut(s) 323
HinfI GANTC 3 cut(s) 29, 72, 95
HphI GGTGA 1 cut(s) 58
Hpy188III TCNNGA 3 cut(s) 92, 166, 364
HpyAV CCTTC 4 cut(s) 15, 43, 97, 114
HpyCH4IV ACGT 1 cut(s) 290
HpyCH4V TGCA 1 cut(s) 206
HpyF3I CTNAG 1 cut(s) 172
HpySE526I ACGT 1 cut(s) 290
LmnI GCTCC 2 cut(s) 52, 142
LpnPI CCDG 4 cut(s) 54, 81, 179, 333
MaeI CTAG 3 cut(s) 285, 296, 370
MaeII ACGT 1 cut(s) 290
MboII GAAGA 3 cut(s) 112, 146, 352
MluCI AATT 3 cut(s) 8, 77, 150
MnlI CCTC 3 cut(s) 204, 311, 368
MseI TTAA 1 cut(s) 57
MspR9I CCNGG 1 cut(s) 69
MvaI CCWGG 1 cut(s) 69
NlaIV GGNNCC 1 cut(s) 130
NspV TTCGAA 2 cut(s) 19, 75
PfeI GAWTC 3 cut(s) 29, 72, 95
Ppu21I YACGTR 1 cut(s) 291
Psp6I CCWGG 1 cut(s) 67
PspFI CCCAGC 1 cut(s) 319
PspGI CCWGG 1 cut(s) 67
PspN4I GGNNCC 1 cut(s) 130
RsaI GTAC 2 cut(s) 26, 289
RsaNI GTAC 2 cut(s) 25, 288
SaqAI TTAA 1 cut(s) 57
ScrFI CCNGG 1 cut(s) 69
SetI ASST 7 cut(s) 26, 57, 118, 178, 272, 286, 293
SfuI TTCGAA 2 cut(s) 19, 75
SnaBI TACGTA 1 cut(s) 291
Sse9I AATT 3 cut(s) 8, 77, 150
SsiI CCGC 1 cut(s) 82
SspMI CTAG 3 cut(s) 285, 296, 370
StyD4I CCNGG 1 cut(s) 67
TaiI ACGT 1 cut(s) 293
TaqI TCGA 3 cut(s) 19, 75, 98
TasI AATT 3 cut(s) 8, 77, 150
TfiI GAWTC 3 cut(s) 29, 72, 95
Tru1I TTAA 1 cut(s) 57
Tru9I TTAA 1 cut(s) 57
XapI RAATTY 2 cut(s) 8, 150
XspI CTAG 3 cut(s) 285, 296, 370
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.