Rroxscaffold_1G00035910

transferase activity, transferring hexosyl groups

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
52368775 .. 52376045
7271 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00035910.1

Sequence Viewer

Length: 372 bp
ATGTTGCGTAATCGTAAAGTTGCTCGTGTGCTCCCTCATATGCGGATTGTGCAAAGAATGACCATGATGCAATACTTTGGGCAAGATGCAATGAGCGAGCCTCTTCAAGAACCAGAGAAGATGACCAATATTATTCTTCAAGCTCTGAAAACTAGTGGACAAAGAGGCATTATCAACAAAGGCTGGGCAAATCCAACTTTAATAATGTTCTTGGCTGGAAACAAGGCTGACTTGGAAGAGAAGAGAAAAGTAGGGACTGAGCATGCCTTCTCCTCAGAAATGTATGACAAGAGTTCAAAGGTAAAGGGTATTTCAAATGGAAACGGTGGCTGTTCTCCTCCAACTGCTCGGGACAAATACGGCCGGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

13.84

Weight (kDa)

10.06

Isoelectric Point (pI)

45.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 43
AcoI YGGCCR 1 cut(s) 361
AgsI TTSAA 4 cut(s) 107, 140, 297, 315
AhlI ACTAGT 1 cut(s) 152
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
Alw21I GWGCWC 1 cut(s) 33
Ama87I CYCGRG 1 cut(s) 348
AoxI GGCC 1 cut(s) 361
AvaI CYCGRG 1 cut(s) 348
BauI CACGAG 1 cut(s) 24
Bbv12I GWGCWC 1 cut(s) 33
BcuI ACTAGT 1 cut(s) 152
BfaI CTAG 1 cut(s) 153
BmeT110I CYCGRG 1 cut(s) 348
BmsI GCATC 2 cut(s) 57, 76
BplI GAGNNNNNCTC 2 cut(s) 85, 117
Bse3DI GCAATG 1 cut(s) 96
BseMI GCAATG 1 cut(s) 96
BseMII CTCAG 2 cut(s) 249, 288
BseRI GAGGAG 2 cut(s) 262, 327
BseX3I CGGCCG 1 cut(s) 361
BseYI CCCAGC 1 cut(s) 183
Bsh1285I CGRYCG 1 cut(s) 364
BshFI GGCC 1 cut(s) 363
BsiEI CGRYCG 1 cut(s) 364
BsiHKAI GWGCWC 1 cut(s) 33
BsiHKCI CYCGRG 1 cut(s) 348
BsiSI CCGG 1 cut(s) 364
BslFI GGGAC 2 cut(s) 268, 365
BsmFI GGGAC 2 cut(s) 268, 365
BsnI GGCC 1 cut(s) 363
BsoBI CYCGRG 1 cut(s) 348
Bsp1286I GDGCHC 1 cut(s) 33
BspACI CCGC 1 cut(s) 43
BspANI GGCC 1 cut(s) 363
BspCNI CTCAG 2 cut(s) 250, 287
BsrDI GCAATG 1 cut(s) 96
BssSI CACGAG 1 cut(s) 24
Bst2BI CACGAG 1 cut(s) 24
Bst4CI ACNGT 1 cut(s) 326
Bst6I CTCTTC 3 cut(s) 108, 231, 236
BstC8I GCNNGC 2 cut(s) 98, 264
BstDEI CTNAG 2 cut(s) 258, 274
BstMCI CGRYCG 1 cut(s) 364
BstMWI GCNNNNNNNGC 1 cut(s) 49
BstNSI RCATGY 1 cut(s) 266
BstZI CGGCCG 1 cut(s) 361
BsuRI GGCC 1 cut(s) 363
Cac8I GCNNGC 2 cut(s) 98, 264
CviAII CATG 2 cut(s) 64, 263
CviJI RGCY 7 cut(s) 100, 143, 183, 215, 227, 330, 363
CviKI_1 RGCY 7 cut(s) 100, 143, 183, 215, 227, 330, 363
DdeI CTNAG 2 cut(s) 258, 274
EaeI YGGCCR 1 cut(s) 361
EagI CGGCCG 1 cut(s) 361
Eam1104I CTCTTC 3 cut(s) 108, 231, 236
EarI CTCTTC 3 cut(s) 108, 231, 236
EclXI CGGCCG 1 cut(s) 361
Eco52I CGGCCG 1 cut(s) 361
Eco88I CYCGRG 1 cut(s) 348
FaeI CATG 2 cut(s) 67, 266
FaiI YATR 5 cut(s) 39, 41, 65, 264, 285
FalI AAGNNNNNCTT 2 cut(s) 215, 247
FaqI GGGAC 2 cut(s) 268, 365
FatI CATG 2 cut(s) 63, 262
FauNDI CATATG 1 cut(s) 39
FspBI CTAG 1 cut(s) 153
GsaI CCCAGC 1 cut(s) 187
HaeIII GGCC 1 cut(s) 363
HapII CCGG 1 cut(s) 364
Hin1II CATG 2 cut(s) 67, 266
HpaII CCGG 1 cut(s) 364
Hpy166II GTNNAC 1 cut(s) 158
Hpy188I TCNGA 2 cut(s) 147, 277
Hpy188III TCNNGA 2 cut(s) 107, 350
Hpy8I GTNNAC 1 cut(s) 158
HpyAV CCTTC 1 cut(s) 277
HpyCH4III ACNGT 1 cut(s) 326
HpyCH4V TGCA 3 cut(s) 52, 70, 89
HpyF10VI GCNNNNNNNGC 1 cut(s) 49
HpyF3I CTNAG 2 cut(s) 258, 274
Hsp92II CATG 2 cut(s) 67, 266
LmnI GCTCC 1 cut(s) 36
LpnPI CCDG 3 cut(s) 126, 169, 201
LweI GCATC 2 cut(s) 57, 76
MaeI CTAG 1 cut(s) 153
MboII GAAGA 5 cut(s) 95, 128, 130, 248, 253
MhlI GDGCHC 1 cut(s) 33
MmeI TCCRAC 2 cut(s) 218, 365
MnlI CCTC 5 cut(s) 45, 111, 158, 283, 348
MseI TTAA 1 cut(s) 200
MspI CCGG 1 cut(s) 364
MwoI GCNNNNNNNGC 1 cut(s) 49
NdeI CATATG 1 cut(s) 39
NlaIII CATG 2 cut(s) 67, 266
NspI RCATGY 1 cut(s) 266
PaeI GCATGC 1 cut(s) 266
PspFI CCCAGC 1 cut(s) 183
SaqAI TTAA 1 cut(s) 200
SduI GDGCHC 1 cut(s) 33
SetI ASST 2 cut(s) 145, 303
SfaNI GCATC 2 cut(s) 57, 76
SpeI ACTAGT 1 cut(s) 152
SphI GCATGC 1 cut(s) 266
SsiI CCGC 1 cut(s) 43
SspI AATATT 1 cut(s) 130
SspMI CTAG 1 cut(s) 153
TaaI ACNGT 1 cut(s) 326
Tru1I TTAA 1 cut(s) 200
Tru9I TTAA 1 cut(s) 200
XceI RCATGY 1 cut(s) 266
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.