RchiOBHm_Chr7g0239551

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
65165069 .. 65168460
3392 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21469

Sequence Viewer

Length: 297 bp
ATGTTCAAATTTTCTTTTCGAAGGTACGATTCGTCTTTGAAATCGGTGAAGGAGCTTAACCAACCCCCTGGATTCGAATTGCGGGGTGTTCGTGAATCGAAGAAGGAGATGATAGGTGGAAGGATGGGTTCCTACTATAAGGAGCATAGAATTCTTCCCCACTTCCAGAACTCAGCTTGCTGTATATCTATTCAATATAACTTTGCAATGAGGCTTGGTGGCTTTGGGATAAGGATGGTTTTATGTTATCTACTTTCAACTCCATCAGCTTTTTGTTTGAAGCTAGTACGTATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

11.38

Weight (kDa)

9.91

Isoelectric Point (pI)

33.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 82
AcsI RAATTY 2 cut(s) 8, 150
AfaI GTAC 2 cut(s) 26, 288
AgsI TTSAA 5 cut(s) 7, 40, 194, 258, 280
AjnI CCWGG 1 cut(s) 67
AluBI AGCT 4 cut(s) 55, 176, 269, 283
AluI AGCT 4 cut(s) 55, 176, 269, 283
ApoI RAATTY 2 cut(s) 8, 150
AsuHPI GGTGA 1 cut(s) 58
AsuII TTCGAA 2 cut(s) 19, 75
BccI CCATC 3 cut(s) 118, 229, 271
BciT130I CCWGG 1 cut(s) 69
BfaI CTAG 2 cut(s) 284, 295
Bme1390I CCNGG 1 cut(s) 69
BmiI GGNNCC 1 cut(s) 130
BmrFI CCNGG 1 cut(s) 69
Bpu14I TTCGAA 2 cut(s) 19, 75
BsaAI YACGTR 1 cut(s) 290
BsaJI CCNNGG 1 cut(s) 67
Bse3DI GCAATG 1 cut(s) 213
BseBI CCWGG 1 cut(s) 69
BseDI CCNNGG 1 cut(s) 67
BseGI GGATG 2 cut(s) 129, 240
BseMI GCAATG 1 cut(s) 213
BseMII CTCAG 1 cut(s) 186
Bsp119I TTCGAA 2 cut(s) 19, 75
BspACI CCGC 1 cut(s) 82
BspCNI CTCAG 1 cut(s) 185
BspLI GGNNCC 1 cut(s) 130
BspT104I TTCGAA 2 cut(s) 19, 75
BsrDI GCAATG 1 cut(s) 213
BssECI CCNNGG 1 cut(s) 67
Bst2UI CCWGG 1 cut(s) 69
BstBAI YACGTR 1 cut(s) 290
BstBI TTCGAA 2 cut(s) 19, 75
BstC8I GCNNGC 1 cut(s) 178
BstDEI CTNAG 1 cut(s) 172
BstF5I GGATG 2 cut(s) 129, 240
BstNI CCWGG 1 cut(s) 69
BstSCI CCNGG 1 cut(s) 67
BstSNI TACGTA 1 cut(s) 290
BstXI CCANNNNNNTGG 1 cut(s) 68
BtsCI GGATG 2 cut(s) 129, 240
Cac8I GCNNGC 1 cut(s) 178
Csp6I GTAC 2 cut(s) 25, 287
CviJI RGCY 6 cut(s) 55, 176, 214, 222, 269, 283
CviKI_1 RGCY 6 cut(s) 55, 176, 214, 222, 269, 283
CviQI GTAC 2 cut(s) 25, 287
DdeI CTNAG 1 cut(s) 172
Eco105I TACGTA 1 cut(s) 290
EcoRI GAATTC 1 cut(s) 150
EcoRII CCWGG 1 cut(s) 67
FaiI YATR 5 cut(s) 138, 147, 185, 198, 244
FauI CCCGC 1 cut(s) 75
FokI GGATG 2 cut(s) 136, 247
FspBI CTAG 2 cut(s) 284, 295
HinfI GANTC 3 cut(s) 29, 72, 95
HphI GGTGA 1 cut(s) 58
Hpy188III TCNNGA 2 cut(s) 92, 166
HpyAV CCTTC 4 cut(s) 15, 43, 97, 114
HpyCH4IV ACGT 1 cut(s) 289
HpyCH4V TGCA 1 cut(s) 206
HpyF3I CTNAG 1 cut(s) 172
HpySE526I ACGT 1 cut(s) 289
LmnI GCTCC 2 cut(s) 52, 142
LpnPI CCDG 3 cut(s) 54, 81, 179
MaeI CTAG 2 cut(s) 284, 295
MaeII ACGT 1 cut(s) 289
MboII GAAGA 2 cut(s) 112, 146
MluCI AATT 3 cut(s) 8, 77, 150
MnlI CCTC 1 cut(s) 204
MseI TTAA 1 cut(s) 57
MspR9I CCNGG 1 cut(s) 69
MvaI CCWGG 1 cut(s) 69
NlaIV GGNNCC 1 cut(s) 130
NspV TTCGAA 2 cut(s) 19, 75
PfeI GAWTC 3 cut(s) 29, 72, 95
Ppu21I YACGTR 1 cut(s) 290
Psp6I CCWGG 1 cut(s) 67
PspGI CCWGG 1 cut(s) 67
PspN4I GGNNCC 1 cut(s) 130
RsaI GTAC 2 cut(s) 26, 288
RsaNI GTAC 2 cut(s) 25, 287
SaqAI TTAA 1 cut(s) 57
ScrFI CCNGG 1 cut(s) 69
SetI ASST 7 cut(s) 26, 57, 118, 178, 271, 285, 292
SfuI TTCGAA 2 cut(s) 19, 75
SgeI CNNG 7 cut(s) 80, 81, 95, 104, 178, 189, 227
SnaBI TACGTA 1 cut(s) 290
Sse9I AATT 3 cut(s) 8, 77, 150
SsiI CCGC 1 cut(s) 82
SspMI CTAG 2 cut(s) 284, 295
StyD4I CCNGG 1 cut(s) 67
TaiI ACGT 1 cut(s) 292
TaqI TCGA 3 cut(s) 19, 75, 98
TasI AATT 3 cut(s) 8, 77, 150
TfiI GAWTC 3 cut(s) 29, 72, 95
Tru1I TTAA 1 cut(s) 57
Tru9I TTAA 1 cut(s) 57
XapI RAATTY 2 cut(s) 8, 150
XspI CTAG 2 cut(s) 284, 295
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.