Rh6AG192800

Ras-related protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
34506672 .. 34509767
3096 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG192800.1

Sequence Viewer

Length: 225 bp
ATGACCAATATTATTCTTCAAGCTCTGAAAATTACTGGACAAAGAGGCATTATCAACAAAGGCCGGGCAAATCCAACTTTAATAATGTTCTTGATTGGAAACAAGGCCGAGTTGGAAGAGAAGAGAAAAGTAGGGACTGAGTTTGGAGTCAAAATTCGTCTAATCACCTCTTTTCGAGATACTTGCTACATTGAGATTCTTCCTAAATACAGGAATGCTACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.42

Weight (kDa)

10.1

Isoelectric Point (pI)

35.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 153
AgsI TTSAA 1 cut(s) 20
AluBI AGCT 1 cut(s) 23
AluI AGCT 1 cut(s) 23
AoxI GGCC 2 cut(s) 61, 105
ApoI RAATTY 1 cut(s) 153
AsuC2I CCSGG 1 cut(s) 65
AsuHPI GGTGA 1 cut(s) 157
BcgI CGANNNNNNTGC 2 cut(s) 165, 199
BcnI CCSGG 1 cut(s) 65
Bme1390I CCNGG 1 cut(s) 65
BmrFI CCNGG 1 cut(s) 65
BpuMI CCSGG 1 cut(s) 65
Bse1I ACTGG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 129
BseNI ACTGG 1 cut(s) 40
BshFI GGCC 2 cut(s) 63, 107
BsiSI CCGG 1 cut(s) 64
BslFI GGGAC 1 cut(s) 148
BsmFI GGGAC 1 cut(s) 148
BsmI GAATGC 1 cut(s) 220
BsnI GGCC 2 cut(s) 63, 107
BspANI GGCC 2 cut(s) 63, 107
BspCNI CTCAG 1 cut(s) 130
BsrI ACTGG 1 cut(s) 40
Bst6I CTCTTC 2 cut(s) 111, 116
BstDEI CTNAG 1 cut(s) 138
BstSCI CCNGG 1 cut(s) 63
BsuRI GGCC 2 cut(s) 63, 107
CviAII CATG 1 cut(s) 222
CviJI RGCY 3 cut(s) 23, 63, 107
CviKI_1 RGCY 3 cut(s) 23, 63, 107
DdeI CTNAG 1 cut(s) 138
Eam1104I CTCTTC 2 cut(s) 111, 116
EarI CTCTTC 2 cut(s) 111, 116
FaeI CATG 1 cut(s) 225
FaiI YATR 1 cut(s) 223
FaqI GGGAC 1 cut(s) 148
FatI CATG 1 cut(s) 221
HaeIII GGCC 2 cut(s) 63, 107
HapII CCGG 1 cut(s) 64
Hin1II CATG 1 cut(s) 225
HinfI GANTC 2 cut(s) 147, 196
HpaII CCGG 1 cut(s) 64
HphI GGTGA 1 cut(s) 157
Hpy188I TCNGA 1 cut(s) 27
Hpy188III TCNNGA 2 cut(s) 91, 176
HpyF3I CTNAG 1 cut(s) 138
Hsp92II CATG 1 cut(s) 225
LpnPI CCDG 3 cut(s) 21, 77, 196
MboII GAAGA 4 cut(s) 8, 128, 133, 191
MluCI AATT 2 cut(s) 30, 153
MlyI GAGTC 1 cut(s) 156
MmeI TCCRAC 2 cut(s) 93, 98
MnlI CCTC 2 cut(s) 38, 178
MseI TTAA 1 cut(s) 80
MspI CCGG 1 cut(s) 64
MspR9I CCNGG 1 cut(s) 65
Mva1269I GAATGC 1 cut(s) 220
NciI CCSGG 1 cut(s) 65
NlaIII CATG 1 cut(s) 225
NmeAIII GCCGAG 1 cut(s) 133
PctI GAATGC 1 cut(s) 220
PfeI GAWTC 1 cut(s) 196
PleI GAGTC 1 cut(s) 155
PpsI GAGTC 1 cut(s) 155
SaqAI TTAA 1 cut(s) 80
SchI GAGTC 1 cut(s) 156
ScrFI CCNGG 1 cut(s) 65
SetI ASST 2 cut(s) 25, 170
SgeI CNNG 9 cut(s) 32, 48, 76, 77, 103, 115, 121, 188, 195
Sse9I AATT 2 cut(s) 30, 153
SspI AATATT 1 cut(s) 10
StyD4I CCNGG 1 cut(s) 63
TaqI TCGA 1 cut(s) 175
TasI AATT 2 cut(s) 30, 153
TfiI GAWTC 1 cut(s) 196
Tru1I TTAA 1 cut(s) 80
Tru9I TTAA 1 cut(s) 80
XapI RAATTY 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.