RchiOBHm_Chr5g0019611

GDP-fucose protein O-fucosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
14066110 .. 14066380
271 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ29974

Sequence Viewer

Length: 156 bp
ATGGGTGTCAAGAGCTCATGTGGTGTAGATGTGAGGTGGCCTACTTATGCATACAACATATTAGGGGGATCAAAAGGGCCTCAAAAATGGATGACAAACATGTCTGGCTCAAGTCTTAAAGAAATTAGCTATGGCTCTAACCAAATTTCATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

5.51

Weight (kDa)

9.14

Isoelectric Point (pI)

68.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 100
AclWI GGATC 1 cut(s) 76
AcsI RAATTY 1 cut(s) 144
AflIII ACRYGT 1 cut(s) 99
AluBI AGCT 2 cut(s) 15, 129
AluI AGCT 2 cut(s) 15, 129
Alw21I GWGCWC 1 cut(s) 17
AlwI GGATC 1 cut(s) 76
AoxI GGCC 2 cut(s) 38, 77
ApoI RAATTY 1 cut(s) 144
AspS9I GGNCC 1 cut(s) 77
BanII GRGCYC 1 cut(s) 17
Bbv12I GWGCWC 1 cut(s) 17
BmgT120I GGNCC 1 cut(s) 77
BpuEI CTTGAG 1 cut(s) 94
BseGI GGATG 1 cut(s) 96
BshFI GGCC 2 cut(s) 40, 79
BsiHKAI GWGCWC 1 cut(s) 17
BsnI GGCC 2 cut(s) 40, 79
Bsp1286I GDGCHC 1 cut(s) 17
Bsp143I GATC 1 cut(s) 68
BspANI GGCC 2 cut(s) 40, 79
BspPI GGATC 1 cut(s) 76
BssMI GATC 1 cut(s) 68
BstF5I GGATG 1 cut(s) 96
BstKTI GATC 1 cut(s) 71
BstMBI GATC 1 cut(s) 68
BstNSI RCATGY 1 cut(s) 103
BsuRI GGCC 2 cut(s) 40, 79
BtsCI GGATG 1 cut(s) 96
Cfr13I GGNCC 1 cut(s) 77
CviAII CATG 3 cut(s) 18, 100, 150
CviJI RGCY 6 cut(s) 15, 40, 79, 108, 129, 135
CviKI_1 RGCY 6 cut(s) 15, 40, 79, 108, 129, 135
DpnI GATC 1 cut(s) 70
DpnII GATC 1 cut(s) 68
DrdI GACNNNNNNGTC 1 cut(s) 100
DseDI GACNNNNNNGTC 1 cut(s) 100
Ecl136II GAGCTC 1 cut(s) 15
Eco24I GRGCYC 1 cut(s) 17
Eco53kI GAGCTC 1 cut(s) 15
EcoICRI GAGCTC 1 cut(s) 15
EcoO109I RGGNCCY 1 cut(s) 77
EcoT22I ATGCAT 1 cut(s) 52
EcoT38I GRGCYC 1 cut(s) 17
FaeI CATG 3 cut(s) 21, 103, 153
FaiI YATR 7 cut(s) 19, 48, 52, 59, 101, 132, 151
FatI CATG 3 cut(s) 17, 99, 149
FokI GGATG 1 cut(s) 103
FriOI GRGCYC 1 cut(s) 17
HaeIII GGCC 2 cut(s) 40, 79
Hin1II CATG 3 cut(s) 21, 103, 153
Hpy188III TCNNGA 1 cut(s) 10
HpyCH4V TGCA 1 cut(s) 50
Hsp92II CATG 3 cut(s) 21, 103, 153
Kzo9I GATC 1 cut(s) 68
LpnPI CCDG 1 cut(s) 90
MalI GATC 1 cut(s) 70
MboI GATC 1 cut(s) 68
MhlI GDGCHC 1 cut(s) 17
MluCI AATT 2 cut(s) 123, 144
MnlI CCTC 2 cut(s) 27, 90
Mph1103I ATGCAT 1 cut(s) 52
MseI TTAA 1 cut(s) 117
NdeII GATC 1 cut(s) 68
NlaIII CATG 3 cut(s) 21, 103, 153
NsiI ATGCAT 1 cut(s) 52
NspI RCATGY 1 cut(s) 103
PciI ACATGT 1 cut(s) 99
PscI ACATGT 1 cut(s) 99
Psp124BI GAGCTC 1 cut(s) 17
PspPI GGNCC 1 cut(s) 77
SacI GAGCTC 1 cut(s) 17
SaqAI TTAA 1 cut(s) 117
Sau3AI GATC 1 cut(s) 68
Sau96I GGNCC 1 cut(s) 77
SduI GDGCHC 1 cut(s) 17
SetI ASST 3 cut(s) 17, 38, 131
SgeI CNNG 5 cut(s) 22, 30, 112, 117, 123
SmlI CTYRAG 1 cut(s) 109
SmoI CTYRAG 1 cut(s) 109
Sse9I AATT 2 cut(s) 123, 144
SstI GAGCTC 1 cut(s) 17
TasI AATT 2 cut(s) 123, 144
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TspDTI ATGAA 1 cut(s) 138
XapI RAATTY 1 cut(s) 144
XceI RCATGY 1 cut(s) 103
Zsp2I ATGCAT 1 cut(s) 52
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.