Rmu_sc0002759.1_g000066

GDP-fucose protein O-fucosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002759.1
Physical Location & Seq
Forward (+)
328313 .. 328674
362 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002759.1_g000066.1.cds

Sequence Viewer

Length: 231 bp
atggagagagtcggcaacattgttgacctcaagactccagctgttgtttatttagctgtggctgacagccttcttcaagatccatcaattttgaatggatggaaagaaggtttctccacattttctagcctcattgctcttgacagaacccagaagctgattaaaatgggtgtcaatagctcatgtggtgcagtgtcggccctgaggctaggcgaagcaggcccaagctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

8.01

Weight (kDa)

6.08

Isoelectric Point (pI)

37.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 74
AgsI TTSAA 2 cut(s) 77, 94
AluBI AGCT 5 cut(s) 41, 56, 157, 180, 228
AluI AGCT 5 cut(s) 41, 56, 157, 180, 228
AlwI GGATC 1 cut(s) 74
AlwNI CAGNNNCTG 1 cut(s) 157
AoxI GGCC 2 cut(s) 198, 220
AspS9I GGNCC 2 cut(s) 199, 221
AxyI CCTNAGG 1 cut(s) 203
BccI CCATC 2 cut(s) 91, 93
BfaI CTAG 2 cut(s) 126, 209
BmgT120I GGNCC 2 cut(s) 199, 221
BpmI CTGGAG 1 cut(s) 21
BpuEI CTTGAG 1 cut(s) 14
Bse21I CCTNAGG 1 cut(s) 203
Bse3DI GCAATG 1 cut(s) 132
BseGI GGATG 1 cut(s) 104
BseMI GCAATG 1 cut(s) 132
BseMII CTCAG 1 cut(s) 194
BsgI GTGCAG 1 cut(s) 210
BshFI GGCC 2 cut(s) 200, 222
BsnI GGCC 2 cut(s) 200, 222
Bsp143I GATC 1 cut(s) 79
BspANI GGCC 2 cut(s) 200, 222
BspCNI CTCAG 1 cut(s) 195
BspPI GGATC 1 cut(s) 74
BsrDI GCAATG 1 cut(s) 132
BssMI GATC 1 cut(s) 79
BstC8I GCNNGC 1 cut(s) 220
BstDEI CTNAG 1 cut(s) 203
BstF5I GGATG 1 cut(s) 104
BstKTI GATC 1 cut(s) 82
BstMBI GATC 1 cut(s) 79
BstMWI GCNNNNNNNGC 2 cut(s) 197, 219
BstX2I RGATCY 1 cut(s) 79
BstYI RGATCY 1 cut(s) 79
Bsu36I CCTNAGG 1 cut(s) 203
BsuRI GGCC 2 cut(s) 200, 222
BtsCI GGATG 1 cut(s) 104
BtsI GCAGTG 1 cut(s) 198
BtsIMutI CAGTG 1 cut(s) 198
Cac8I GCNNGC 1 cut(s) 220
CaiI CAGNNNCTG 1 cut(s) 157
Cfr13I GGNCC 2 cut(s) 199, 221
CviAII CATG 1 cut(s) 183
DdeI CTNAG 1 cut(s) 203
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
Eco81I CCTNAGG 1 cut(s) 203
FaeI CATG 1 cut(s) 186
FaiI YATR 1 cut(s) 184
FatI CATG 1 cut(s) 182
FokI GGATG 1 cut(s) 111
FspBI CTAG 2 cut(s) 126, 209
GsuI CTGGAG 1 cut(s) 21
HaeIII GGCC 2 cut(s) 200, 222
Hin1II CATG 1 cut(s) 186
HincII GTYRAC 1 cut(s) 25
HindII GTYRAC 1 cut(s) 25
HinfI GANTC 2 cut(s) 9, 34
Hpy166II GTNNAC 1 cut(s) 25
Hpy188III TCNNGA 3 cut(s) 31, 77, 140
Hpy8I GTNNAC 1 cut(s) 25
HpyAV CCTTC 2 cut(s) 80, 101
HpyCH4V TGCA 1 cut(s) 191
HpyF10VI GCNNNNNNNGC 2 cut(s) 197, 219
HpyF3I CTNAG 1 cut(s) 203
Hsp92II CATG 1 cut(s) 186
Kzo9I GATC 1 cut(s) 79
LpnPI CCDG 4 cut(s) 51, 164, 204, 215
MaeI CTAG 2 cut(s) 126, 209
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MboII GAAGA 1 cut(s) 65
MflI RGATCY 1 cut(s) 79
MluCI AATT 1 cut(s) 87
MlyI GAGTC 2 cut(s) 18, 28
MnlI CCTC 3 cut(s) 38, 140, 198
MseI TTAA 1 cut(s) 162
MspA1I CMGCKG 1 cut(s) 41
MwoI GCNNNNNNNGC 2 cut(s) 197, 219
NdeII GATC 1 cut(s) 79
NlaIII CATG 1 cut(s) 186
PleI GAGTC 2 cut(s) 17, 28
PpsI GAGTC 2 cut(s) 17, 28
PspPI GGNCC 2 cut(s) 199, 221
PstNI CAGNNNCTG 1 cut(s) 157
PsuI RGATCY 1 cut(s) 79
PvuII CAGCTG 1 cut(s) 41
SaqAI TTAA 1 cut(s) 162
Sau3AI GATC 1 cut(s) 79
Sau96I GGNCC 2 cut(s) 199, 221
SchI GAGTC 2 cut(s) 18, 28
SetI ASST 7 cut(s) 30, 43, 58, 112, 159, 182, 230
SgeI CNNG 9 cut(s) 43, 50, 89, 138, 152, 163, 195, 214, 221
SmlI CTYRAG 1 cut(s) 29
SmoI CTYRAG 1 cut(s) 29
Sse9I AATT 1 cut(s) 87
SspMI CTAG 2 cut(s) 126, 209
TasI AATT 1 cut(s) 87
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TscAI CASTG 1 cut(s) 198
TspRI CASTG 1 cut(s) 198
XspI CTAG 2 cut(s) 126, 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.