Rroxscaffold_1G00058470

GDP-fucose protein O-fucosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
80359285 .. 80359613
329 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00058470.1

Sequence Viewer

Length: 198 bp
ATGGAGAGAGTTGGCAACACTATTGGCTTCAAGACTCCAGCTGTTGTTTATTTAGCTGTGGCTGATGGTCTTCTTCAAGATCCATCAATTTTGAATGGATGGAAAGAAGGTTTCTCTACATTTTCTAGCCTCATTGCTCTTGACAGAACCCAGAAGCTGATTAAAACGGGTGTCAATAGCTCATGTGGTGTAGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

6.91

Weight (kDa)

7.9

Isoelectric Point (pI)

24.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 74
AgsI TTSAA 3 cut(s) 31, 77, 94
AluBI AGCT 4 cut(s) 41, 56, 157, 180
AluI AGCT 4 cut(s) 41, 56, 157, 180
AlwI GGATC 1 cut(s) 74
AlwNI CAGNNNCTG 1 cut(s) 157
BbsI GAAGAC 1 cut(s) 62
BccI CCATC 3 cut(s) 59, 91, 93
BfaI CTAG 1 cut(s) 126
BpiI GAAGAC 1 cut(s) 62
BpmI CTGGAG 1 cut(s) 21
Bse3DI GCAATG 1 cut(s) 132
BseGI GGATG 1 cut(s) 104
BseMI GCAATG 1 cut(s) 132
Bsp143I GATC 1 cut(s) 79
BspPI GGATC 1 cut(s) 74
BsrDI GCAATG 1 cut(s) 132
BssMI GATC 1 cut(s) 79
BstF5I GGATG 1 cut(s) 104
BstKTI GATC 1 cut(s) 82
BstMBI GATC 1 cut(s) 79
BstV2I GAAGAC 1 cut(s) 62
BstX2I RGATCY 1 cut(s) 79
BstYI RGATCY 1 cut(s) 79
BtsCI GGATG 1 cut(s) 104
CaiI CAGNNNCTG 1 cut(s) 157
CviAII CATG 1 cut(s) 183
CviJI RGCY 7 cut(s) 27, 41, 56, 62, 129, 157, 180
CviKI_1 RGCY 7 cut(s) 27, 41, 56, 62, 129, 157, 180
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
FaeI CATG 1 cut(s) 186
FaiI YATR 1 cut(s) 184
FatI CATG 1 cut(s) 182
FokI GGATG 1 cut(s) 111
FspBI CTAG 1 cut(s) 126
GsuI CTGGAG 1 cut(s) 21
Hin1II CATG 1 cut(s) 186
HinfI GANTC 1 cut(s) 34
Hpy188III TCNNGA 3 cut(s) 31, 77, 140
HpyAV CCTTC 1 cut(s) 101
Hsp92II CATG 1 cut(s) 186
Kzo9I GATC 1 cut(s) 79
LpnPI CCDG 2 cut(s) 51, 164
MaeI CTAG 1 cut(s) 126
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MboII GAAGA 2 cut(s) 62, 65
MflI RGATCY 1 cut(s) 79
MluCI AATT 1 cut(s) 87
MlyI GAGTC 1 cut(s) 28
MnlI CCTC 1 cut(s) 140
MseI TTAA 1 cut(s) 162
MspA1I CMGCKG 1 cut(s) 41
NdeII GATC 1 cut(s) 79
NlaIII CATG 1 cut(s) 186
PleI GAGTC 1 cut(s) 28
PpsI GAGTC 1 cut(s) 28
PstNI CAGNNNCTG 1 cut(s) 157
PsuI RGATCY 1 cut(s) 79
PvuII CAGCTG 1 cut(s) 41
SaqAI TTAA 1 cut(s) 162
Sau3AI GATC 1 cut(s) 79
SchI GAGTC 1 cut(s) 28
SetI ASST 5 cut(s) 43, 58, 112, 159, 182
SgeI CNNG 7 cut(s) 43, 50, 89, 138, 152, 163, 180
Sse9I AATT 1 cut(s) 87
SspMI CTAG 1 cut(s) 126
TasI AATT 1 cut(s) 87
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.