RchiOBHm_Chr5g0022281

RIO1 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
16297964 .. 16298424
461 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30224

Sequence Viewer

Length: 180 bp
ATGAGGAAAGCAAGACGGCTTGGGGTGCATATATACTCTGGTGCTTTACAATGTGGACACCGTGTTGCATACCCTGACATTGAATATGTGGAGGGGCCTTCTGTTAAAGATGTGTTTCTTGAGTTTGGGTTAGGAGGTGGTCGTGTGGCTTCAGAAATTGTTGTTATTTATGATTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

6.58

Weight (kDa)

6.71

Isoelectric Point (pI)

52.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017086)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 135
AgsI TTSAA 1 cut(s) 83
AoxI GGCC 1 cut(s) 95
AspS9I GGNCC 1 cut(s) 95
BceAI ACGGC 1 cut(s) 32
BmgT120I GGNCC 1 cut(s) 95
BmiI GGNNCC 1 cut(s) 96
BpuEI CTTGAG 1 cut(s) 140
BshFI GGCC 1 cut(s) 97
BsnI GGCC 1 cut(s) 97
BspANI GGCC 1 cut(s) 97
BspLI GGNNCC 1 cut(s) 96
Bst4CI ACNGT 1 cut(s) 62
BstMWI GCNNNNNNNGC 1 cut(s) 25
BsuRI GGCC 1 cut(s) 97
Cfr13I GGNCC 1 cut(s) 95
CviJI RGCY 3 cut(s) 19, 97, 149
CviKI_1 RGCY 3 cut(s) 19, 97, 149
Eco57I CTGAAG 1 cut(s) 135
EcoO109I RGGNCCY 1 cut(s) 95
FaiI YATR 6 cut(s) 30, 32, 34, 70, 87, 171
HaeIII GGCC 1 cut(s) 97
Hpy166II GTNNAC 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 154
Hpy188III TCNNGA 1 cut(s) 119
Hpy8I GTNNAC 1 cut(s) 56
HpyAV CCTTC 1 cut(s) 108
HpyCH4III ACNGT 1 cut(s) 62
HpyCH4V TGCA 2 cut(s) 28, 68
HpyF10VI GCNNNNNNNGC 1 cut(s) 25
LpnPI CCDG 2 cut(s) 24, 87
MluCI AATT 1 cut(s) 156
MnlI CCTC 2 cut(s) 85, 128
MseI TTAA 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 25
NlaIV GGNNCC 1 cut(s) 96
PspN4I GGNNCC 1 cut(s) 96
PspPI GGNCC 1 cut(s) 95
SaqAI TTAA 1 cut(s) 105
Sau96I GGNCC 1 cut(s) 95
SetI ASST 1 cut(s) 139
SgeI CNNG 7 cut(s) 24, 32, 51, 74, 86, 131, 155
SmlI CTYRAG 1 cut(s) 119
SmoI CTYRAG 1 cut(s) 119
Sse9I AATT 1 cut(s) 156
TaaI ACNGT 1 cut(s) 62
TasI AATT 1 cut(s) 156
Tru1I TTAA 1 cut(s) 105
Tru9I TTAA 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.