RchiOBHm_Chr5g0029961

ATP synthase subunit alpha

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0009874
Physical Location & Seq
Forward (+)
23783950 .. 23784111
162 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30932

Sequence Viewer

Length: 162 bp
ATGGAATATTCCATTCTTGTAGTAGCCACCGCTTCGGATCCGGCTCCTCTACAATTTCTGGCCCCATATTCTGGGTGTGCCATGGGGGAATATTTCCGTGATAATGGAATGCACGCATTAATAATCTATTATGATCTTAGTAAACAGGCGGTGGCATATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00190 ko01100 ko04714 ko05010 ko05012 ko05016 map00190 map01100 map04714 map05010 map05012 map05016
Pfam Domains
Protein Families
ATP-synt_ab ATP-synt_ab_C ATP-synt_ab_N COX2_TM

Protein Analysis

53

Amino Acids

5.87

Weight (kDa)

4.43

Isoelectric Point (pI)

46.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATP-synt_ab PF00006 1 - 53 1.5e-14 ATP synthase alpha/beta family, nucleotide-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 71
AciI CCGC 2 cut(s) 30, 149
AclWI GGATC 2 cut(s) 32, 45
AfiI CCNNNNNNNGG 1 cut(s) 71
AlwI GGATC 2 cut(s) 32, 45
AoxI GGCC 1 cut(s) 60
AseI ATTAAT 1 cut(s) 119
AspS9I GGNCC 1 cut(s) 61
BamHI GGATCC 1 cut(s) 37
BmgT120I GGNCC 1 cut(s) 61
BmiI GGNNCC 3 cut(s) 39, 45, 63
BsaJI CCNNGG 1 cut(s) 81
Bsc4I CCNNNNNNNGG 1 cut(s) 71
BseDI CCNNGG 1 cut(s) 81
BseLI CCNNNNNNNGG 1 cut(s) 71
BseRI GAGGAG 1 cut(s) 36
BshFI GGCC 1 cut(s) 62
BsiSI CCGG 1 cut(s) 41
BslI CCNNNNNNNGG 1 cut(s) 71
BsmI GAATGC 1 cut(s) 114
BsnI GGCC 1 cut(s) 62
Bsp143I GATC 2 cut(s) 37, 133
Bsp19I CCATGG 1 cut(s) 81
BspACI CCGC 2 cut(s) 30, 149
BspANI GGCC 1 cut(s) 62
BspLI GGNNCC 3 cut(s) 39, 45, 63
BspPI GGATC 2 cut(s) 32, 45
BssECI CCNNGG 1 cut(s) 81
BssMI GATC 2 cut(s) 37, 133
BssT1I CCWWGG 1 cut(s) 81
BstC8I GCNNGC 1 cut(s) 114
BstDEI CTNAG 1 cut(s) 137
BstDSI CCRYGG 1 cut(s) 81
BstKTI GATC 2 cut(s) 40, 136
BstMBI GATC 2 cut(s) 37, 133
BstX2I RGATCY 1 cut(s) 37
BstYI RGATCY 1 cut(s) 37
BsuRI GGCC 1 cut(s) 62
BtgI CCRYGG 1 cut(s) 81
Cac8I GCNNGC 1 cut(s) 114
Cfr13I GGNCC 1 cut(s) 61
CviAII CATG 1 cut(s) 82
CviJI RGCY 3 cut(s) 26, 44, 62
CviKI_1 RGCY 3 cut(s) 26, 44, 62
DdeI CTNAG 1 cut(s) 137
DpnI GATC 2 cut(s) 39, 135
DpnII GATC 2 cut(s) 37, 133
Eco130I CCWWGG 1 cut(s) 81
EcoT14I CCWWGG 1 cut(s) 81
ErhI CCWWGG 1 cut(s) 81
FaeI CATG 1 cut(s) 85
FaiI YATR 4 cut(s) 67, 83, 132, 157
FatI CATG 1 cut(s) 81
HaeIII GGCC 1 cut(s) 62
HapII CCGG 1 cut(s) 41
Hin1II CATG 1 cut(s) 85
HpaII CCGG 1 cut(s) 41
Hpy166II GTNNAC 1 cut(s) 143
Hpy188I TCNGA 1 cut(s) 37
Hpy8I GTNNAC 1 cut(s) 143
HpyCH4V TGCA 1 cut(s) 112
HpyF3I CTNAG 1 cut(s) 137
Hsp92II CATG 1 cut(s) 85
Kzo9I GATC 2 cut(s) 37, 133
LmnI GCTCC 1 cut(s) 49
LpnPI CCDG 4 cut(s) 44, 54, 57, 131
MalI GATC 2 cut(s) 39, 135
MboI GATC 2 cut(s) 37, 133
MflI RGATCY 1 cut(s) 37
MluCI AATT 1 cut(s) 53
MnlI CCTC 1 cut(s) 57
MseI TTAA 1 cut(s) 119
MspI CCGG 1 cut(s) 41
Mva1269I GAATGC 1 cut(s) 114
NcoI CCATGG 1 cut(s) 81
NdeII GATC 2 cut(s) 37, 133
NlaIII CATG 1 cut(s) 85
NlaIV GGNNCC 3 cut(s) 39, 45, 63
PctI GAATGC 1 cut(s) 114
PflMI CCANNNNNTGG 1 cut(s) 71
PshBI ATTAAT 1 cut(s) 119
PspN4I GGNNCC 3 cut(s) 39, 45, 63
PspPI GGNCC 1 cut(s) 61
PsuI RGATCY 1 cut(s) 37
SaqAI TTAA 1 cut(s) 119
Sau3AI GATC 2 cut(s) 37, 133
Sau96I GGNCC 1 cut(s) 61
SgeI CNNG 8 cut(s) 29, 53, 71, 84, 94, 110, 125, 158
Sse9I AATT 1 cut(s) 53
SsiI CCGC 2 cut(s) 30, 149
SspI AATATT 2 cut(s) 8, 92
StyI CCWWGG 1 cut(s) 81
TasI AATT 1 cut(s) 53
Tru1I TTAA 1 cut(s) 119
Tru9I TTAA 1 cut(s) 119
TspGWI ACGGA 1 cut(s) 86
Van91I CCANNNNNTGG 1 cut(s) 71
VspI ATTAAT 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.