RchiOBHm_Chr5g0045481

Ankyrin repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
41463927 .. 41464787
861 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32358

Sequence Viewer

Length: 165 bp
ATGTCTAGCCCACAAGCACACAATTCTGTACCGCCTGGAATTCCATTGACGGCTACTGGTAATGGAGATCCAATAGCAACTGCACATTGCGTCGTCAACATTCCCTCGACACCTTCGCTTTTTTTTCTAGAAAAAAAAATAGTGTGTACCTATCTTCCTCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

5.65

Weight (kDa)

6.69

Isoelectric Point (pI)

53.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018616)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 32
AclWI GGATC 1 cut(s) 62
AcsI RAATTY 1 cut(s) 39
AfaI GTAC 2 cut(s) 30, 148
AjnI CCWGG 1 cut(s) 34
AlwI GGATC 1 cut(s) 62
ApoI RAATTY 1 cut(s) 39
BceAI ACGGC 1 cut(s) 66
BciT130I CCWGG 1 cut(s) 36
BfaI CTAG 2 cut(s) 6, 128
Bme1390I CCNGG 1 cut(s) 36
BmrFI CCNGG 1 cut(s) 36
Bse1I ACTGG 1 cut(s) 61
Bse3DI GCAATG 1 cut(s) 85
BseBI CCWGG 1 cut(s) 36
BseMI GCAATG 1 cut(s) 85
BseNI ACTGG 1 cut(s) 61
BsgI GTGCAG 1 cut(s) 66
Bsp143I GATC 1 cut(s) 67
BspACI CCGC 1 cut(s) 32
BspPI GGATC 1 cut(s) 62
BsrDI GCAATG 1 cut(s) 85
BsrI ACTGG 1 cut(s) 61
BssMI GATC 1 cut(s) 67
Bst2UI CCWGG 1 cut(s) 36
BstKTI GATC 1 cut(s) 70
BstMBI GATC 1 cut(s) 67
BstNI CCWGG 1 cut(s) 36
BstSCI CCNGG 1 cut(s) 34
BstX2I RGATCY 1 cut(s) 67
BstYI RGATCY 1 cut(s) 67
CseI GACGC 1 cut(s) 79
Csp6I GTAC 2 cut(s) 29, 147
CviJI RGCY 2 cut(s) 9, 53
CviKI_1 RGCY 2 cut(s) 9, 53
CviQI GTAC 2 cut(s) 29, 147
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
EcoRI GAATTC 1 cut(s) 39
EcoRII CCWGG 1 cut(s) 34
FspBI CTAG 2 cut(s) 6, 128
HgaI GACGC 1 cut(s) 79
HincII GTYRAC 1 cut(s) 97
HindII GTYRAC 1 cut(s) 97
Hpy166II GTNNAC 2 cut(s) 97, 147
Hpy188III TCNNGA 1 cut(s) 128
Hpy8I GTNNAC 2 cut(s) 97, 147
Hpy99I CGWCG 1 cut(s) 95
HpyAV CCTTC 1 cut(s) 123
HpyCH4V TGCA 1 cut(s) 83
Kzo9I GATC 1 cut(s) 67
LpnPI CCDG 3 cut(s) 21, 42, 48
MaeI CTAG 2 cut(s) 6, 128
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MboII GAAGA 1 cut(s) 146
MflI RGATCY 1 cut(s) 67
MluCI AATT 2 cut(s) 22, 39
MnlI CCTC 1 cut(s) 115
MseI TTAA 1 cut(s) 163
MspR9I CCNGG 1 cut(s) 36
MvaI CCWGG 1 cut(s) 36
NdeII GATC 1 cut(s) 67
Psp6I CCWGG 1 cut(s) 34
PspGI CCWGG 1 cut(s) 34
PsuI RGATCY 1 cut(s) 67
RsaI GTAC 2 cut(s) 30, 148
RsaNI GTAC 2 cut(s) 29, 147
SaqAI TTAA 1 cut(s) 163
Sau3AI GATC 1 cut(s) 67
ScrFI CCNGG 1 cut(s) 36
SetI ASST 2 cut(s) 115, 152
SgeI CNNG 7 cut(s) 18, 26, 47, 48, 69, 118, 140
Sse9I AATT 2 cut(s) 22, 39
SsiI CCGC 1 cut(s) 32
SspMI CTAG 2 cut(s) 6, 128
StyD4I CCNGG 1 cut(s) 34
TaqI TCGA 1 cut(s) 107
TasI AATT 2 cut(s) 22, 39
Tru1I TTAA 1 cut(s) 163
Tru9I TTAA 1 cut(s) 163
XapI RAATTY 1 cut(s) 39
XbaI TCTAGA 1 cut(s) 127
XspI CTAG 2 cut(s) 6, 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.