Rh5BG312500

Ankyrin repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
41304932 .. 41311666
6735 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG312500.1

Sequence Viewer

Length: 177 bp
ATGGCTACTGGTAATGGAGATCGAATCGCAACTGCACATTACGTCATCAACATTCCCTCGATACCTTCACCTTCGCATCATTTGCTGGAAAACCACAACAAAAAAGTTAACAAAAGAAAAACAGGCACGAAGACAGCTACTATAGCGGGCCATGACTATCCAAAGAATAGAATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.39

Weight (kDa)

10.21

Isoelectric Point (pI)

50.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018616)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 146
AluBI AGCT 1 cut(s) 137
AluI AGCT 1 cut(s) 137
AoxI GGCC 1 cut(s) 148
AspS9I GGNCC 1 cut(s) 148
AsuHPI GGTGA 1 cut(s) 60
BbsI GAAGAC 1 cut(s) 137
BfaI CTAG 1 cut(s) 175
BfmI CTRYAG 1 cut(s) 141
BmgT120I GGNCC 1 cut(s) 148
BmsI GCATC 1 cut(s) 85
BpiI GAAGAC 1 cut(s) 137
Bse1I ACTGG 1 cut(s) 13
BseNI ACTGG 1 cut(s) 13
BsgI GTGCAG 1 cut(s) 18
BshFI GGCC 1 cut(s) 150
BsnI GGCC 1 cut(s) 150
Bsp143I GATC 1 cut(s) 19
BspACI CCGC 1 cut(s) 146
BspANI GGCC 1 cut(s) 150
BsrI ACTGG 1 cut(s) 13
BssMI GATC 1 cut(s) 19
BstAPI GCANNNNNTGC 1 cut(s) 82
BstC8I GCNNGC 1 cut(s) 148
BstKTI GATC 1 cut(s) 22
BstMBI GATC 1 cut(s) 19
BstMWI GCNNNNNNNGC 2 cut(s) 82, 143
BstSFI CTRYAG 1 cut(s) 141
BstV2I GAAGAC 1 cut(s) 137
BsuRI GGCC 1 cut(s) 150
Cac8I GCNNGC 1 cut(s) 148
Cfr13I GGNCC 1 cut(s) 148
CviAII CATG 1 cut(s) 152
CviJI RGCY 3 cut(s) 5, 137, 150
CviKI_1 RGCY 3 cut(s) 5, 137, 150
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
FaeI CATG 1 cut(s) 155
FaiI YATR 2 cut(s) 143, 153
FatI CATG 1 cut(s) 151
FauI CCCGC 1 cut(s) 139
FspBI CTAG 1 cut(s) 175
HaeIII GGCC 1 cut(s) 150
Hin1II CATG 1 cut(s) 155
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
HinfI GANTC 2 cut(s) 24, 171
HpaI GTTAAC 1 cut(s) 109
HphI GGTGA 1 cut(s) 60
Hpy166II GTNNAC 1 cut(s) 109
Hpy8I GTNNAC 1 cut(s) 109
HpyAV CCTTC 2 cut(s) 75, 81
HpyCH4IV ACGT 1 cut(s) 42
HpyCH4V TGCA 1 cut(s) 35
HpyF10VI GCNNNNNNNGC 2 cut(s) 82, 143
HpySE526I ACGT 1 cut(s) 42
Hsp92II CATG 1 cut(s) 155
KspAI GTTAAC 1 cut(s) 109
Kzo9I GATC 1 cut(s) 19
LpnPI CCDG 2 cut(s) 71, 108
LweI GCATC 1 cut(s) 85
MaeI CTAG 1 cut(s) 175
MaeII ACGT 1 cut(s) 42
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MboII GAAGA 1 cut(s) 142
MnlI CCTC 1 cut(s) 67
MseI TTAA 1 cut(s) 108
MwoI GCNNNNNNNGC 2 cut(s) 82, 143
NdeII GATC 1 cut(s) 19
NlaIII CATG 1 cut(s) 155
PfeI GAWTC 2 cut(s) 24, 171
PspPI GGNCC 1 cut(s) 148
SaqAI TTAA 1 cut(s) 108
Sau3AI GATC 1 cut(s) 19
Sau96I GGNCC 1 cut(s) 148
SetI ASST 4 cut(s) 45, 67, 73, 139
SfaNI GCATC 1 cut(s) 85
SfcI CTRYAG 1 cut(s) 141
SgeI CNNG 7 cut(s) 21, 70, 98, 135, 139, 159, 164
SsiI CCGC 1 cut(s) 146
SspMI CTAG 1 cut(s) 175
TaiI ACGT 1 cut(s) 45
TaqI TCGA 2 cut(s) 22, 59
TfiI GAWTC 2 cut(s) 24, 171
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
XspI CTAG 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.