Rh5AG264400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
34733492 .. 34734360
869 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG264400.1

Sequence Viewer

Length: 303 bp
ATGAGGTCCATCTCTGACTACCATTTAACTCCCCCTAGCCAAACATCTTACTATCTCAAAGTTTCTACATGCTCTTGCAGGAGTGAATTAGCTTCACAAGCAAAGCTGTGGAGGTTCAATTTGGAACCAATGTCTACCACACAAGCACACAATTCTATACCGCCTGGAAATGCATTGAGGGCTACGAGAGATCCAATGACATTTGCACCTTACACGCCTGGCAATAGTATGGAGCCAATTAATCTTCCTCTTTACTCTTACCTAGATTGTGTGGGGAAGCTACTATATACATATCTGTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.29

Weight (kDa)

8.39

Isoelectric Point (pI)

42.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018616)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 134
AciI CCGC 1 cut(s) 161
AclWI GGATC 1 cut(s) 185
AgsI TTSAA 1 cut(s) 118
AjnI CCWGG 2 cut(s) 163, 217
AluBI AGCT 3 cut(s) 92, 106, 280
AluI AGCT 3 cut(s) 92, 106, 280
AlwI GGATC 1 cut(s) 185
AseI ATTAAT 1 cut(s) 240
AspS9I GGNCC 1 cut(s) 6
AvaII GGWCC 1 cut(s) 6
BccI CCATC 1 cut(s) 17
BciT130I CCWGG 2 cut(s) 165, 219
BfaI CTAG 2 cut(s) 36, 263
Bme1390I CCNGG 2 cut(s) 165, 219
Bme18I GGWCC 1 cut(s) 6
BmgT120I GGNCC 1 cut(s) 6
BmiI GGNNCC 2 cut(s) 126, 234
BmrFI CCNGG 2 cut(s) 165, 219
BseBI CCWGG 2 cut(s) 165, 219
Bsp143I GATC 1 cut(s) 190
BspACI CCGC 1 cut(s) 161
BspLI GGNNCC 2 cut(s) 126, 234
BspPI GGATC 1 cut(s) 185
BssMI GATC 1 cut(s) 190
Bst2UI CCWGG 2 cut(s) 165, 219
BstKTI GATC 1 cut(s) 193
BstMBI GATC 1 cut(s) 190
BstMWI GCNNNNNNNGC 2 cut(s) 98, 179
BstNI CCWGG 2 cut(s) 165, 219
BstNSI RCATGY 1 cut(s) 72
BstSCI CCNGG 2 cut(s) 163, 217
BstX2I RGATCY 1 cut(s) 190
BstYI RGATCY 1 cut(s) 190
Cfr13I GGNCC 1 cut(s) 6
CviAII CATG 1 cut(s) 69
CviJI RGCY 6 cut(s) 39, 92, 106, 182, 235, 280
CviKI_1 RGCY 6 cut(s) 39, 92, 106, 182, 235, 280
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
Eco47I GGWCC 1 cut(s) 6
EcoRII CCWGG 2 cut(s) 163, 217
EcoT22I ATGCAT 1 cut(s) 175
FaeI CATG 1 cut(s) 72
FaiI YATR 6 cut(s) 70, 158, 230, 286, 288, 292
FatI CATG 1 cut(s) 68
FblI GTMKAC 1 cut(s) 134
FspBI CTAG 2 cut(s) 36, 263
Hin1II CATG 1 cut(s) 72
Hpy166II GTNNAC 1 cut(s) 135
Hpy188I TCNGA 1 cut(s) 16
Hpy8I GTNNAC 1 cut(s) 135
HpyCH4V TGCA 3 cut(s) 78, 173, 206
HpyF10VI GCNNNNNNNGC 2 cut(s) 98, 179
Hsp92II CATG 1 cut(s) 72
Kzo9I GATC 1 cut(s) 190
LmnI GCTCC 1 cut(s) 232
LpnPI CCDG 5 cut(s) 64, 150, 177, 204, 231
MaeI CTAG 2 cut(s) 36, 263
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 1 cut(s) 236
MflI RGATCY 1 cut(s) 190
MluCI AATT 4 cut(s) 86, 118, 151, 237
MnlI CCTC 3 cut(s) 105, 171, 258
Mph1103I ATGCAT 1 cut(s) 175
MseI TTAA 3 cut(s) 26, 240, 301
MslI CAYNNNNRTG 1 cut(s) 295
MspR9I CCNGG 2 cut(s) 165, 219
MvaI CCWGG 2 cut(s) 165, 219
MwoI GCNNNNNNNGC 2 cut(s) 98, 179
NdeII GATC 1 cut(s) 190
NlaIII CATG 1 cut(s) 72
NlaIV GGNNCC 2 cut(s) 126, 234
NsiI ATGCAT 1 cut(s) 175
NspI RCATGY 1 cut(s) 72
PshBI ATTAAT 1 cut(s) 240
Psp6I CCWGG 2 cut(s) 163, 217
PspGI CCWGG 2 cut(s) 163, 217
PspN4I GGNNCC 2 cut(s) 126, 234
PspPI GGNCC 1 cut(s) 6
PsuI RGATCY 1 cut(s) 190
RseI CAYNNNNRTG 1 cut(s) 295
SaqAI TTAA 3 cut(s) 26, 240, 301
Sau3AI GATC 1 cut(s) 190
Sau96I GGNCC 1 cut(s) 6
ScrFI CCNGG 2 cut(s) 165, 219
SetI ASST 7 cut(s) 8, 94, 108, 116, 211, 264, 282
SinI GGWCC 1 cut(s) 6
SmiMI CAYNNNNRTG 1 cut(s) 295
Sse9I AATT 4 cut(s) 86, 118, 151, 237
SsiI CCGC 1 cut(s) 161
SspMI CTAG 2 cut(s) 36, 263
StyD4I CCNGG 2 cut(s) 163, 217
TasI AATT 4 cut(s) 86, 118, 151, 237
Tru1I TTAA 3 cut(s) 26, 240, 301
Tru9I TTAA 3 cut(s) 26, 240, 301
VpaK11BI GGWCC 1 cut(s) 6
VspI ATTAAT 1 cut(s) 240
XceI RCATGY 1 cut(s) 72
XmiI GTMKAC 1 cut(s) 134
XspI CTAG 2 cut(s) 36, 263
Zsp2I ATGCAT 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.