Rh5BG269400

Ankyrin repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0018616
Physical Location & Seq
Reverse (-)
33607541 .. 33610936
3396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG269400.1

Sequence Viewer

Length: 882 bp
ATGAGGTCCATCTCTGACTATTATTTAACTCCCCCTAGCCAAACATCTTACTATCTCAAAGTTTCTACATGCTCTTGCAGGAGTGAATTAGCTTCACAAGCAAAGCTGTGGAGGTTCAATTTGGAACCAATGTCTACCACACAAGCACACAATTCTATACCGCCTGGAATTGCATTGAGAGCTATGAGAGATCCAATGACATTTGCACCTTACACGCCTGGCAATAGACAGTATTACCTTGATGTATGTGTGCCGCTCAATAAGTATGCACTAAAAGGCAATTGGGAAGCTGTTGAACTAATCTTGAGGAAGGACCCGAGGCTTTTGACTGCTAGCATAACAAGCGGAGGTGACACAGTCCTTCACATAGCAACAGGAGCAAGACAAGTTCAGTTTGTGGAGGAGCTGGTTGAAATGATGGAAGTATGGATTGGAACGGAGAAATGTTCACAAGCCTTGGCAAAGCAAGGCACGAACGGAAACACTGCCTTCAGCATTGCCGCTGCAGCTGGAAGTAATGAAATTGCACAGATTATGATGAAGAAGAATGAGCATTTGCCAAAAATTCGAGGTGGTGAAGGAATGACACCACTCTATACGGCTGCCTTGTCGGGACAATCTCTAATGGCAGATTACTTGTACTCTCTAACCAAGGACATGTTGGAGGAAGCCGATCGGCAACTGTTGTTTTTAACTTGTATCGATAATGGATTGTATGATCTAGCTAGGAAGATGCTAGAAAGTGACAGAGCATTAGCTAAGGTTCGTAATATAAAAGAGGAAACAGCTTTGCATATCTTGGCTAGAATGCCTTTAGAATTCACCAGCCAAAGTCCAGGAATGTGGAGTAGACTCATCACCTCATGTGAGTTGGTTCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank_2 PGG

Protein Analysis

293

Amino Acids

32.66

Weight (kDa)

6.9

Isoelectric Point (pI)

41.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ank_2 PF12796 156 - 218 8e-07 Ankyrin repeats (3 copies)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018616)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0045481
rosa_laevigata RLG00000034364
rosa_samantha Rh5AG264400 Rh5AG304300 Rh5BG269400 Rh5BG312500 Rh5CG303000 Rh5CG339400 Rh5CG342500
rosa_wichuraiana Rw5G028250

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 256
AccI GTMKAC 2 cut(s) 134, 850
AciI CCGC 4 cut(s) 161, 254, 345, 501
AclWI GGATC 1 cut(s) 185
AcsI RAATTY 2 cut(s) 564, 818
AcuI CTGAAG 1 cut(s) 475
AfaI GTAC 1 cut(s) 641
AflIII ACRYGT 1 cut(s) 657
AgsI TTSAA 3 cut(s) 118, 296, 413
AjnI CCWGG 3 cut(s) 163, 217, 835
AjuI GAANNNNNNNTTGG 2 cut(s) 414, 446
AluBI AGCT 9 cut(s) 92, 106, 182, 290, 406, 509, 725, 758, 788
AluI AGCT 9 cut(s) 92, 106, 182, 290, 406, 509, 725, 758, 788
AlwI GGATC 1 cut(s) 185
Ama87I CYCGRG 1 cut(s) 316
ApeKI GCWGC 3 cut(s) 503, 506, 602
ApoI RAATTY 2 cut(s) 564, 818
AspS9I GGNCC 2 cut(s) 6, 313
AsuHPI GGTGA 4 cut(s) 362, 587, 814, 850
AsuNHI GCTAGC 1 cut(s) 332
AvaI CYCGRG 1 cut(s) 316
AvaII GGWCC 2 cut(s) 6, 313
BbvI GCAGC 3 cut(s) 490, 518, 589
BccI CCATC 2 cut(s) 17, 412
BceAI ACGGC 1 cut(s) 615
BciT130I CCWGG 3 cut(s) 165, 219, 837
BfaI CTAG 6 cut(s) 36, 333, 722, 726, 737, 804
BfmI CTRYAG 1 cut(s) 504
BisI GCNGC 5 cut(s) 254, 501, 504, 507, 603
BlsI GCNGC 5 cut(s) 255, 502, 505, 508, 604
Bme1390I CCNGG 3 cut(s) 165, 219, 837
Bme18I GGWCC 2 cut(s) 6, 313
BmeT110I CYCGRG 1 cut(s) 316
BmgT120I GGNCC 2 cut(s) 6, 313
BmiI GGNNCC 2 cut(s) 126, 315
BmrFI CCNGG 3 cut(s) 165, 219, 837
BmsI GCATC 1 cut(s) 723
BmtI GCTAGC 1 cut(s) 336
Bpu10I CCTNAGC 1 cut(s) 759
BpuEI CTTGAG 1 cut(s) 325
Bsa29I ATCGAT 1 cut(s) 702
BsaJI CCNNGG 3 cut(s) 317, 456, 651
Bse3DI GCAATG 1 cut(s) 495
BseBI CCWGG 3 cut(s) 165, 219, 837
BseCI ATCGAT 1 cut(s) 702
BseDI CCNNGG 3 cut(s) 317, 456, 651
BseMI GCAATG 1 cut(s) 495
BseRI GAGGAG 1 cut(s) 416
BseXI GCAGC 3 cut(s) 490, 518, 589
Bsh1285I CGRYCG 1 cut(s) 676
BshVI ATCGAT 1 cut(s) 702
BsiEI CGRYCG 1 cut(s) 676
BsiHKCI CYCGRG 1 cut(s) 316
BslFI GGGAC 1 cut(s) 627
BsmFI GGGAC 1 cut(s) 627
BsmI GAATGC 1 cut(s) 813
BsoBI CYCGRG 1 cut(s) 316
Bsp143I GATC 3 cut(s) 190, 673, 718
BspACI CCGC 4 cut(s) 161, 254, 345, 501
BspDI ATCGAT 1 cut(s) 702
BspLI GGNNCC 2 cut(s) 126, 315
BspMAI CTGCAG 1 cut(s) 508
BspOI GCTAGC 1 cut(s) 336
BspPI GGATC 1 cut(s) 185
BsrBI CCGCTC 1 cut(s) 256
BsrDI GCAATG 1 cut(s) 495
BssECI CCNNGG 3 cut(s) 317, 456, 651
BssMI GATC 3 cut(s) 190, 673, 718
BssT1I CCWWGG 2 cut(s) 456, 651
Bst2UI CCWGG 3 cut(s) 165, 219, 837
Bst4CI ACNGT 3 cut(s) 231, 358, 684
BstC8I GCNNGC 1 cut(s) 334
BstDEI CTNAG 1 cut(s) 759
BstKTI GATC 3 cut(s) 193, 676, 721
BstMBI GATC 3 cut(s) 190, 673, 718
BstMCI CGRYCG 1 cut(s) 676
BstMWI GCNNNNNNNGC 5 cut(s) 98, 179, 342, 377, 506
BstNI CCWGG 3 cut(s) 165, 219, 837
BstNSI RCATGY 2 cut(s) 72, 661
BstSCI CCNGG 3 cut(s) 163, 217, 835
BstSFI CTRYAG 1 cut(s) 504
BstV1I GCAGC 3 cut(s) 490, 518, 589
BstX2I RGATCY 1 cut(s) 190
BstXI CCANNNNNNTGG 1 cut(s) 843
BstYI RGATCY 1 cut(s) 190
Bsu15I ATCGAT 1 cut(s) 702
BsuTUI ATCGAT 1 cut(s) 702
BtsI GCAGTG 1 cut(s) 483
BtsIMutI CAGTG 1 cut(s) 483
Cac8I GCNNGC 1 cut(s) 334
Cfr13I GGNCC 2 cut(s) 6, 313
ClaI ATCGAT 1 cut(s) 702
Csp6I GTAC 1 cut(s) 640
CviAII CATG 3 cut(s) 69, 658, 864
CviQI GTAC 1 cut(s) 640
DdeI CTNAG 1 cut(s) 759
DpnI GATC 3 cut(s) 192, 675, 720
DpnII GATC 3 cut(s) 190, 673, 718
Eco130I CCWWGG 2 cut(s) 456, 651
Eco47I GGWCC 2 cut(s) 6, 313
Eco57I CTGAAG 1 cut(s) 475
Eco88I CYCGRG 1 cut(s) 316
EcoO109I RGGNCCY 1 cut(s) 313
EcoRI GAATTC 1 cut(s) 818
EcoRII CCWGG 3 cut(s) 163, 217, 835
EcoT14I CCWWGG 2 cut(s) 456, 651
ErhI CCWWGG 2 cut(s) 456, 651
FaeI CATG 3 cut(s) 72, 661, 867
FaqI GGGAC 1 cut(s) 627
FatI CATG 3 cut(s) 68, 657, 863
FblI GTMKAC 2 cut(s) 134, 850
Fnu4HI GCNGC 5 cut(s) 254, 501, 504, 507, 603
Fsp4HI GCNGC 5 cut(s) 254, 501, 504, 507, 603
FspBI CTAG 6 cut(s) 36, 333, 722, 726, 737, 804
GluI GCNGC 5 cut(s) 254, 501, 504, 507, 603
Hin1II CATG 3 cut(s) 72, 661, 867
HinfI GANTC 1 cut(s) 852
HphI GGTGA 4 cut(s) 362, 587, 814, 850
Hpy166II GTNNAC 3 cut(s) 135, 449, 851
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 2 cut(s) 304, 612
Hpy8I GTNNAC 3 cut(s) 135, 449, 851
HpyAV CCTTC 4 cut(s) 304, 371, 499, 572
HpyCH4III ACNGT 3 cut(s) 231, 358, 684
HpyCH4V TGCA 7 cut(s) 78, 173, 206, 269, 506, 527, 793
HpyF10VI GCNNNNNNNGC 5 cut(s) 98, 179, 342, 377, 506
HpyF3I CTNAG 1 cut(s) 759
Hsp92II CATG 3 cut(s) 72, 661, 867
Kzo9I GATC 3 cut(s) 190, 673, 718
LmnI GCTCC 2 cut(s) 377, 403
Lsp1109I GCAGC 3 cut(s) 490, 518, 589
LweI GCATC 1 cut(s) 723
MaeI CTAG 6 cut(s) 36, 333, 722, 726, 737, 804
MaeIII GTNAC 2 cut(s) 350, 743
MalI GATC 3 cut(s) 192, 675, 720
MbiI CCGCTC 1 cut(s) 256
MboI GATC 3 cut(s) 190, 673, 718
MboII GAAGA 3 cut(s) 553, 556, 742
MfeI CAATTG 1 cut(s) 280
MflI RGATCY 1 cut(s) 190
MluCI AATT 8 cut(s) 86, 118, 151, 168, 280, 522, 564, 818
MlyI GAGTC 1 cut(s) 846
MmeI TCCRAC 1 cut(s) 642
MnlI CCTC 9 cut(s) 105, 300, 312, 341, 394, 563, 658, 772, 871
MseI TTAA 3 cut(s) 26, 692, 880
MspA1I CMGCKG 2 cut(s) 503, 509
MspR9I CCNGG 3 cut(s) 165, 219, 837
MunI CAATTG 1 cut(s) 280
Mva1269I GAATGC 1 cut(s) 813
MvaI CCWGG 3 cut(s) 165, 219, 837
MwoI GCNNNNNNNGC 5 cut(s) 98, 179, 342, 377, 506
NdeII GATC 3 cut(s) 190, 673, 718
NheI GCTAGC 1 cut(s) 332
NlaIII CATG 3 cut(s) 72, 661, 867
NlaIV GGNNCC 2 cut(s) 126, 315
NmuCI GTSAC 2 cut(s) 350, 743
NspI RCATGY 2 cut(s) 72, 661
PciI ACATGT 1 cut(s) 657
PctI GAATGC 1 cut(s) 813
PflFI GACNNNGTC 1 cut(s) 356
PfoI TCCNGGA 1 cut(s) 835
PkrI GCNGC 5 cut(s) 255, 502, 505, 508, 604
Ple19I CGATCG 1 cut(s) 676
PleI GAGTC 1 cut(s) 846
PpsI GAGTC 1 cut(s) 846
PpuMI RGGWCCY 1 cut(s) 313
PscI ACATGT 1 cut(s) 657
Psp5II RGGWCCY 1 cut(s) 313
Psp6I CCWGG 3 cut(s) 163, 217, 835
PspGI CCWGG 3 cut(s) 163, 217, 835
PspN4I GGNNCC 2 cut(s) 126, 315
PspPI GGNCC 2 cut(s) 6, 313
PspPPI RGGWCCY 1 cut(s) 313
PstI CTGCAG 1 cut(s) 508
PsuI RGATCY 1 cut(s) 190
PsyI GACNNNGTC 1 cut(s) 356
PvuI CGATCG 1 cut(s) 676
PvuII CAGCTG 1 cut(s) 509
RsaI GTAC 1 cut(s) 641
RsaNI GTAC 1 cut(s) 640
SaqAI TTAA 3 cut(s) 26, 692, 880
SatI GCNGC 5 cut(s) 254, 501, 504, 507, 603
Sau3AI GATC 3 cut(s) 190, 673, 718
Sau96I GGNCC 2 cut(s) 6, 313
SchI GAGTC 1 cut(s) 846
ScrFI CCNGG 3 cut(s) 165, 219, 837
SfaNI GCATC 1 cut(s) 723
SfcI CTRYAG 1 cut(s) 504
SinI GGWCC 2 cut(s) 6, 313
SmlI CTYRAG 1 cut(s) 304
SmoI CTYRAG 1 cut(s) 304
Sse9I AATT 8 cut(s) 86, 118, 151, 168, 280, 522, 564, 818
SsiI CCGC 4 cut(s) 161, 254, 345, 501
SspMI CTAG 6 cut(s) 36, 333, 722, 726, 737, 804
StyD4I CCNGG 3 cut(s) 163, 217, 835
StyI CCWWGG 2 cut(s) 456, 651
TaaI ACNGT 3 cut(s) 231, 358, 684
TaqI TCGA 2 cut(s) 568, 702
TasI AATT 8 cut(s) 86, 118, 151, 168, 280, 522, 564, 818
TatI WGTACW 1 cut(s) 639
TauI GCSGC 2 cut(s) 256, 503
Tru1I TTAA 3 cut(s) 26, 692, 880
Tru9I TTAA 3 cut(s) 26, 692, 880
TscAI CASTG 1 cut(s) 490
TseFI GTSAC 2 cut(s) 350, 743
TseI GCWGC 3 cut(s) 503, 506, 602
Tsp45I GTSAC 2 cut(s) 350, 743
TspDTI ATGAA 2 cut(s) 534, 554
TspGWI ACGGA 2 cut(s) 452, 492
TspRI CASTG 1 cut(s) 490
Tth111I GACNNNGTC 1 cut(s) 356
VpaK11BI GGWCC 2 cut(s) 6, 313
XapI RAATTY 2 cut(s) 564, 818
XceI RCATGY 2 cut(s) 72, 661
XcmI CCANNNNNNNNNTGG 1 cut(s) 658
XmiI GTMKAC 2 cut(s) 134, 850
XspI CTAG 6 cut(s) 36, 333, 722, 726, 737, 804
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.