RchiOBHm_Chr5g0048211

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
44920454 .. 44920689
236 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32601

Sequence Viewer

Length: 162 bp
ATGCCTATCCTGGCGTTTAACATCATCTATGGTGTTCTTGTGGCTTTTGGAACTGGTATTACCGTTGGACTTATCTTGTCATGCTGCTATGTGGTGGGAGTTGTGCAGAGGGAGAACATGATTGCCAAGAATGTGGCTCTTGGCAACCGTCCTGCTCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.62

Weight (kDa)

8.84

Isoelectric Point (pI)

34.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018199)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 9
ApeKI GCWGC 1 cut(s) 84
BbvI GCAGC 1 cut(s) 71
BciT130I CCWGG 1 cut(s) 11
BisI GCNGC 1 cut(s) 85
BlsI GCNGC 1 cut(s) 86
Bme1390I CCNGG 1 cut(s) 11
BmrFI CCNGG 1 cut(s) 11
Bse1I ACTGG 1 cut(s) 58
BseBI CCWGG 1 cut(s) 11
BseNI ACTGG 1 cut(s) 58
BseXI GCAGC 1 cut(s) 71
BsgI GTGCAG 1 cut(s) 125
BsrI ACTGG 1 cut(s) 58
Bst2UI CCWGG 1 cut(s) 11
Bst4CI ACNGT 2 cut(s) 64, 149
BstNI CCWGG 1 cut(s) 11
BstSCI CCNGG 1 cut(s) 9
BstV1I GCAGC 1 cut(s) 71
BstXI CCANNNNNNTGG 1 cut(s) 133
CviAII CATG 2 cut(s) 81, 118
CviJI RGCY 2 cut(s) 44, 137
CviKI_1 RGCY 2 cut(s) 44, 137
EcoRII CCWGG 1 cut(s) 9
FaeI CATG 2 cut(s) 84, 121
FaiI YATR 4 cut(s) 30, 82, 90, 119
FatI CATG 2 cut(s) 80, 117
Fnu4HI GCNGC 1 cut(s) 85
Fsp4HI GCNGC 1 cut(s) 85
GluI GCNGC 1 cut(s) 85
Hin1II CATG 2 cut(s) 84, 121
HpyCH4III ACNGT 2 cut(s) 64, 149
HpyCH4V TGCA 1 cut(s) 106
Hsp92II CATG 2 cut(s) 84, 121
LpnPI CCDG 2 cut(s) 23, 39
Lsp1109I GCAGC 1 cut(s) 71
MmeI TCCRAC 1 cut(s) 46
MnlI CCTC 1 cut(s) 102
MseI TTAA 2 cut(s) 18, 160
MspR9I CCNGG 1 cut(s) 11
MvaI CCWGG 1 cut(s) 11
NlaIII CATG 2 cut(s) 84, 121
PkrI GCNGC 1 cut(s) 86
Psp6I CCWGG 1 cut(s) 9
PspGI CCWGG 1 cut(s) 9
PsrI GAACNNNNNNTAC 2 cut(s) 43, 75
SaqAI TTAA 2 cut(s) 18, 160
SatI GCNGC 1 cut(s) 85
ScrFI CCNGG 1 cut(s) 11
SgeI CNNG 9 cut(s) 22, 23, 50, 66, 88, 93, 130, 139, 152
StyD4I CCNGG 1 cut(s) 9
TaaI ACNGT 2 cut(s) 64, 149
Tru1I TTAA 2 cut(s) 18, 160
Tru9I TTAA 2 cut(s) 18, 160
TseI GCWGC 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.