Rmu_sc0033697.1_g000001

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0033697.1
Physical Location & Seq
Reverse (-)
1 .. 1058
1058 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0033697.1_g000001.1.cds

Sequence Viewer

Length: 167 bp
atgatacagactttggacttatctaacaacaacttaacaggaccaattcctgacttcttgtctcaaatgtcaaatttaaatgtcataaacttggagaacaacaagctcacaggctcagttccaaataaacttactgaaagagcaaaaaatggtttactatcattaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

55

Amino Acids

6.01

Weight (kDa)

5.97

Isoelectric Point (pI)

24.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018199)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 73
AhdI GACNNNNNGTC 1 cut(s) 58
AluBI AGCT 1 cut(s) 106
AluI AGCT 1 cut(s) 106
Alw26I GTCTC 1 cut(s) 66
ApoI RAATTY 1 cut(s) 73
AspS9I GGNCC 1 cut(s) 41
AvaII GGWCC 1 cut(s) 41
BcoDI GTCTC 1 cut(s) 66
Bme18I GGWCC 1 cut(s) 41
BmeRI GACNNNNNGTC 1 cut(s) 58
BmgT120I GGNCC 1 cut(s) 41
BseMII CTCAG 1 cut(s) 129
BsmAI GTCTC 1 cut(s) 66
BspCNI CTCAG 1 cut(s) 128
BstDEI CTNAG 1 cut(s) 115
BstMAI GTCTC 1 cut(s) 66
Cfr13I GGNCC 1 cut(s) 41
CviJI RGCY 2 cut(s) 106, 114
CviKI_1 RGCY 2 cut(s) 106, 114
DdeI CTNAG 1 cut(s) 115
DraI TTTAAA 1 cut(s) 78
DriI GACNNNNNGTC 1 cut(s) 58
Eam1105I GACNNNNNGTC 1 cut(s) 58
Eco47I GGWCC 1 cut(s) 41
FaiI YATR 1 cut(s) 86
FspEI CC 7 cut(s) 24, 57, 63, 77, 96, 135, 135
Hpy166II GTNNAC 1 cut(s) 155
Hpy188III TCNNGA 1 cut(s) 50
Hpy8I GTNNAC 1 cut(s) 155
HpyF3I CTNAG 1 cut(s) 115
LpnPI CCDG 3 cut(s) 24, 63, 96
MluCI AATT 2 cut(s) 45, 73
MseI TTAA 3 cut(s) 35, 77, 164
PspPI GGNCC 1 cut(s) 41
SaqAI TTAA 3 cut(s) 35, 77, 164
Sau96I GGNCC 1 cut(s) 41
SetI ASST 1 cut(s) 108
SgeI CNNG 6 cut(s) 51, 62, 70, 103, 115, 123
SinI GGWCC 1 cut(s) 41
SmiI ATTTAAAT 1 cut(s) 78
Sse9I AATT 2 cut(s) 45, 73
SwaI ATTTAAAT 1 cut(s) 78
TasI AATT 2 cut(s) 45, 73
Tru1I TTAA 3 cut(s) 35, 77, 164
Tru9I TTAA 3 cut(s) 35, 77, 164
VpaK11BI GGWCC 1 cut(s) 41
XapI RAATTY 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.