Rh2DG440300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
63942179 .. 63942495
317 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG440300.1

Sequence Viewer

Length: 243 bp
ATGCTTTCTCATTTTTGCTTGGCATACTTGATCATATTGCTTTGTCTGCTGGTATTTGGGATCATTGCTGGTGCTATTCACATGCCTATCCTGGCGTTTAACATCATCTATGGTGTTCTTGTGGCTTTTGGAACTGGTATTACCATTGGACTTATCTTGTCATGCTGCTATGTGGTGGGAGTTGTGCAGAGGGAGAACATGATTGCCAAGAATGTGGCTCTTGGCAACCGTCCTGCTCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

8.57

Weight (kDa)

8.48

Isoelectric Point (pI)

32.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018199)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 68
AjnI CCWGG 1 cut(s) 90
AlwI GGATC 1 cut(s) 68
ApeKI GCWGC 1 cut(s) 165
BbvI GCAGC 1 cut(s) 152
BciT130I CCWGG 1 cut(s) 92
BclI TGATCA 1 cut(s) 30
BisI GCNGC 1 cut(s) 166
BlsI GCNGC 1 cut(s) 167
Bme1390I CCNGG 1 cut(s) 92
BmrFI CCNGG 1 cut(s) 92
Bse1I ACTGG 1 cut(s) 139
Bse3DI GCAATG 1 cut(s) 63
BseBI CCWGG 1 cut(s) 92
BseMI GCAATG 1 cut(s) 63
BseNI ACTGG 1 cut(s) 139
BseXI GCAGC 1 cut(s) 152
BsgI GTGCAG 1 cut(s) 206
Bsp143I GATC 2 cut(s) 30, 60
BspPI GGATC 1 cut(s) 68
BsrDI GCAATG 1 cut(s) 63
BsrI ACTGG 1 cut(s) 139
BssMI GATC 2 cut(s) 30, 60
Bst2UI CCWGG 1 cut(s) 92
Bst4CI ACNGT 1 cut(s) 230
BstKTI GATC 2 cut(s) 33, 63
BstMBI GATC 2 cut(s) 30, 60
BstMWI GCNNNNNNNGC 1 cut(s) 46
BstNI CCWGG 1 cut(s) 92
BstNSI RCATGY 1 cut(s) 85
BstSCI CCNGG 1 cut(s) 90
BstV1I GCAGC 1 cut(s) 152
BstXI CCANNNNNNTGG 1 cut(s) 214
CviAII CATG 3 cut(s) 82, 162, 199
CviJI RGCY 2 cut(s) 125, 218
CviKI_1 RGCY 2 cut(s) 125, 218
DpnI GATC 2 cut(s) 32, 62
DpnII GATC 2 cut(s) 30, 60
EcoRII CCWGG 1 cut(s) 90
FaeI CATG 3 cut(s) 85, 165, 202
FaiI YATR 7 cut(s) 25, 35, 83, 111, 163, 171, 200
FatI CATG 3 cut(s) 81, 161, 198
FbaI TGATCA 1 cut(s) 30
Fnu4HI GCNGC 1 cut(s) 166
Fsp4HI GCNGC 1 cut(s) 166
GluI GCNGC 1 cut(s) 166
Hin1II CATG 3 cut(s) 85, 165, 202
HpyCH4III ACNGT 1 cut(s) 230
HpyCH4V TGCA 1 cut(s) 187
HpyF10VI GCNNNNNNNGC 1 cut(s) 46
Hsp92II CATG 3 cut(s) 85, 165, 202
Ksp22I TGATCA 1 cut(s) 30
Kzo9I GATC 2 cut(s) 30, 60
LpnPI CCDG 5 cut(s) 35, 54, 77, 104, 120
Lsp1109I GCAGC 1 cut(s) 152
MalI GATC 2 cut(s) 32, 62
MboI GATC 2 cut(s) 30, 60
MnlI CCTC 1 cut(s) 183
MseI TTAA 2 cut(s) 99, 241
MspR9I CCNGG 1 cut(s) 92
MvaI CCWGG 1 cut(s) 92
MwoI GCNNNNNNNGC 1 cut(s) 46
NdeII GATC 2 cut(s) 30, 60
NlaIII CATG 3 cut(s) 85, 165, 202
NspI RCATGY 1 cut(s) 85
PkrI GCNGC 1 cut(s) 167
Psp6I CCWGG 1 cut(s) 90
PspGI CCWGG 1 cut(s) 90
PsrI GAACNNNNNNTAC 2 cut(s) 124, 156
SaqAI TTAA 2 cut(s) 99, 241
SatI GCNGC 1 cut(s) 166
Sau3AI GATC 2 cut(s) 30, 60
ScrFI CCNGG 1 cut(s) 92
StyD4I CCNGG 1 cut(s) 90
TaaI ACNGT 1 cut(s) 230
Tru1I TTAA 2 cut(s) 99, 241
Tru9I TTAA 2 cut(s) 99, 241
TseI GCWGC 1 cut(s) 165
XceI RCATGY 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.