Rmu_sc0002928.1_g000003

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002928.1
Physical Location & Seq
Reverse (-)
10668 .. 11334
667 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002928.1_g000003.1.cds

Sequence Viewer

Length: 339 bp
atgcaaatgatcaggcacttgccctggagtggattacaaggggagataactccttctatatttaaacttgtaatgatacaatctttgaacctatcaaacaacaatttgacaggaccaattccaaaggttttgtctcaactgccaaacttagttttcctggatttgtcaaacaacaaattaactggtcgaattccagatattttctctcaaatgccaaagttaaatatcttaaacttagagaacaacaagctcacaggctctattccggaaggactaattcgaagaatgaatagcggtttcttgtcattaaggtatgtccctttctacagaaaatcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

112

Amino Acids

12.71

Weight (kDa)

10.43

Isoelectric Point (pI)

44.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018199)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 265
AciI CCGC 1 cut(s) 294
AcsI RAATTY 1 cut(s) 189
AfiI CCNNNNNNNGG 1 cut(s) 29
AgsI TTSAA 1 cut(s) 88
AjnI CCWGG 2 cut(s) 23, 156
AluBI AGCT 1 cut(s) 250
AluI AGCT 1 cut(s) 250
Alw26I GTCTC 1 cut(s) 138
Aor13HI TCCGGA 1 cut(s) 265
ApoI RAATTY 1 cut(s) 189
ArsI GACNNNNNNTTYG 2 cut(s) 116, 148
AspS9I GGNCC 1 cut(s) 113
AsuII TTCGAA 1 cut(s) 280
AvaII GGWCC 1 cut(s) 113
BciT130I CCWGG 2 cut(s) 25, 158
BclI TGATCA 1 cut(s) 9
BcoDI GTCTC 1 cut(s) 138
BfmI CTRYAG 1 cut(s) 325
Bme1390I CCNGG 2 cut(s) 25, 158
Bme18I GGWCC 1 cut(s) 113
BmgT120I GGNCC 1 cut(s) 113
BmrFI CCNGG 2 cut(s) 25, 158
BpmI CTGGAG 1 cut(s) 46
Bpu14I TTCGAA 1 cut(s) 280
BsaJI CCNNGG 1 cut(s) 23
BsaWI WCCGGW 1 cut(s) 265
Bsc4I CCNNNNNNNGG 1 cut(s) 29
Bse1I ACTGG 1 cut(s) 187
BseAI TCCGGA 1 cut(s) 265
BseBI CCWGG 2 cut(s) 25, 158
BseDI CCNNGG 1 cut(s) 23
BseLI CCNNNNNNNGG 1 cut(s) 29
BseNI ACTGG 1 cut(s) 187
BsiSI CCGG 1 cut(s) 266
BslFI GGGAC 1 cut(s) 302
BslI CCNNNNNNNGG 1 cut(s) 29
BsmAI GTCTC 1 cut(s) 138
BsmFI GGGAC 1 cut(s) 302
Bsp119I TTCGAA 1 cut(s) 280
Bsp13I TCCGGA 1 cut(s) 265
Bsp143I GATC 1 cut(s) 9
BspACI CCGC 1 cut(s) 294
BspEI TCCGGA 1 cut(s) 265
BspHI TCATGA 1 cut(s) 335
BspT104I TTCGAA 1 cut(s) 280
BsrI ACTGG 1 cut(s) 187
BssECI CCNNGG 1 cut(s) 23
BssMI GATC 1 cut(s) 9
Bst2UI CCWGG 2 cut(s) 25, 158
BstBI TTCGAA 1 cut(s) 280
BstDEI CTNAG 2 cut(s) 148, 235
BstKTI GATC 1 cut(s) 12
BstMAI GTCTC 1 cut(s) 138
BstMBI GATC 1 cut(s) 9
BstNI CCWGG 2 cut(s) 25, 158
BstSCI CCNGG 2 cut(s) 23, 156
BstSFI CTRYAG 1 cut(s) 325
CciI TCATGA 1 cut(s) 335
Cfr13I GGNCC 1 cut(s) 113
CviAII CATG 1 cut(s) 336
CviJI RGCY 2 cut(s) 250, 258
CviKI_1 RGCY 2 cut(s) 250, 258
DdeI CTNAG 2 cut(s) 148, 235
DpnI GATC 1 cut(s) 11
DpnII GATC 1 cut(s) 9
DraI TTTAAA 1 cut(s) 64
Eco47I GGWCC 1 cut(s) 113
EcoRI GAATTC 1 cut(s) 189
EcoRII CCWGG 2 cut(s) 23, 156
FaeI CATG 1 cut(s) 339
FaiI YATR 3 cut(s) 59, 315, 337
FaqI GGGAC 1 cut(s) 302
FatI CATG 1 cut(s) 335
FbaI TGATCA 1 cut(s) 9
GsuI CTGGAG 1 cut(s) 46
HapII CCGG 1 cut(s) 266
Hin1II CATG 1 cut(s) 339
HpaII CCGG 1 cut(s) 266
Hpy188III TCNNGA 3 cut(s) 194, 266, 336
HpyAV CCTTC 2 cut(s) 63, 263
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 2 cut(s) 148, 235
Hsp92II CATG 1 cut(s) 339
Kpn2I TCCGGA 1 cut(s) 265
Ksp22I TGATCA 1 cut(s) 9
Kzo9I GATC 1 cut(s) 9
LpnPI CCDG 9 cut(s) 10, 37, 96, 143, 168, 170, 207, 240, 279
MalI GATC 1 cut(s) 11
MboI GATC 1 cut(s) 9
MboII GAAGA 1 cut(s) 294
MluCI AATT 5 cut(s) 103, 117, 176, 189, 276
MroI TCCGGA 1 cut(s) 265
MseI TTAA 5 cut(s) 63, 179, 221, 230, 308
MspI CCGG 1 cut(s) 266
MspR9I CCNGG 2 cut(s) 25, 158
MvaI CCWGG 2 cut(s) 25, 158
NdeII GATC 1 cut(s) 9
NlaIII CATG 1 cut(s) 339
NspV TTCGAA 1 cut(s) 280
PagI TCATGA 1 cut(s) 335
PfoI TCCNGGA 1 cut(s) 156
Psp6I CCWGG 2 cut(s) 23, 156
PspGI CCWGG 2 cut(s) 23, 156
PspPI GGNCC 1 cut(s) 113
SaqAI TTAA 5 cut(s) 63, 179, 221, 230, 308
Sau3AI GATC 1 cut(s) 9
Sau96I GGNCC 1 cut(s) 113
ScrFI CCNGG 2 cut(s) 25, 158
SetI ASST 4 cut(s) 93, 129, 252, 314
SfcI CTRYAG 1 cut(s) 325
SfuI TTCGAA 1 cut(s) 280
SinI GGWCC 1 cut(s) 113
Sse9I AATT 5 cut(s) 103, 117, 176, 189, 276
SsiI CCGC 1 cut(s) 294
StyD4I CCNGG 2 cut(s) 23, 156
TaqI TCGA 2 cut(s) 187, 280
TasI AATT 5 cut(s) 103, 117, 176, 189, 276
Tru1I TTAA 5 cut(s) 63, 179, 221, 230, 308
Tru9I TTAA 5 cut(s) 63, 179, 221, 230, 308
TspDTI ATGAA 1 cut(s) 302
VpaK11BI GGWCC 1 cut(s) 113
XapI RAATTY 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.