Rroxscaffold_1G00007860

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
10004131 .. 10006131
2001 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00007860.1

Sequence Viewer

Length: 153 bp
ATGCCTATCCTGGTGTATGTTGGTGTTCATGTGGCTGTTATAGCTGGTGTTGCCGTTGGACTTATCTTTTTATACTGCCATCCGATGGAAGTTGTGCAGAGAGAGAACGCGATTGCTGAGATTGTGGTTCTTGGCAACTATCCTGCTCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.39

Weight (kDa)

5.74

Isoelectric Point (pI)

27.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018199)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 85
AccII CGCG 1 cut(s) 110
AfiI CCNNNNNNNGG 1 cut(s) 85
AjnI CCWGG 1 cut(s) 9
AluBI AGCT 1 cut(s) 44
AluI AGCT 1 cut(s) 44
BccI CCATC 2 cut(s) 79, 87
BceAI ACGGC 1 cut(s) 38
BciT130I CCWGG 1 cut(s) 11
Bme1390I CCNGG 1 cut(s) 11
BmrFI CCNGG 1 cut(s) 11
Bsc4I CCNNNNNNNGG 1 cut(s) 85
BseBI CCWGG 1 cut(s) 11
BseGI GGATG 1 cut(s) 79
BseLI CCNNNNNNNGG 1 cut(s) 85
BseMII CTCAG 1 cut(s) 108
BsgI GTGCAG 1 cut(s) 116
Bsh1236I CGCG 1 cut(s) 110
BslI CCNNNNNNNGG 1 cut(s) 85
BspCNI CTCAG 1 cut(s) 109
BspFNI CGCG 1 cut(s) 110
Bst2UI CCWGG 1 cut(s) 11
BstDEI CTNAG 1 cut(s) 117
BstF5I GGATG 1 cut(s) 79
BstFNI CGCG 1 cut(s) 110
BstMWI GCNNNNNNNGC 2 cut(s) 41, 50
BstNI CCWGG 1 cut(s) 11
BstSCI CCNGG 1 cut(s) 9
BstUI CGCG 1 cut(s) 110
BtsCI GGATG 1 cut(s) 79
CviAII CATG 1 cut(s) 29
CviJI RGCY 2 cut(s) 35, 44
CviKI_1 RGCY 2 cut(s) 35, 44
DdeI CTNAG 1 cut(s) 117
EcoRII CCWGG 1 cut(s) 9
FaeI CATG 1 cut(s) 32
FaiI YATR 4 cut(s) 18, 30, 41, 73
FatI CATG 1 cut(s) 28
FokI GGATG 1 cut(s) 66
Hin1II CATG 1 cut(s) 32
Hpy188I TCNGA 1 cut(s) 84
HpyCH4V TGCA 1 cut(s) 97
HpyF10VI GCNNNNNNNGC 2 cut(s) 41, 50
HpyF3I CTNAG 1 cut(s) 117
Hsp92II CATG 1 cut(s) 32
LpnPI CCDG 2 cut(s) 23, 30
MmeI TCCRAC 1 cut(s) 37
MspR9I CCNGG 1 cut(s) 11
MvaI CCWGG 1 cut(s) 11
MvnI CGCG 1 cut(s) 110
MwoI GCNNNNNNNGC 2 cut(s) 41, 50
NlaIII CATG 1 cut(s) 32
PflMI CCANNNNNTGG 1 cut(s) 85
Psp6I CCWGG 1 cut(s) 9
PspGI CCWGG 1 cut(s) 9
ScrFI CCNGG 1 cut(s) 11
SetI ASST 1 cut(s) 46
SgeI CNNG 6 cut(s) 22, 23, 41, 57, 121, 143
StyD4I CCNGG 1 cut(s) 9
TspDTI ATGAA 1 cut(s) 17
Van91I CCANNNNNTGG 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.