RchiOBHm_Chr6g0255051

Subtilisin-like serine endopeptidase family protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
10280640 .. 10282556
1917 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22878

Sequence Viewer

Length: 168 bp
ATGAAAACAGAAAGGTCCAGAGTGTACCTCGGCTCACTTCCAGATAATAATAAGTGGTACTTACCATTGTCTCACCACCTTTGTATACTAGAAAGAGTTGTCAAGAATGGCTCGGGTGCAAATCCGTTGTCAAAAGTTACAAAAGGAGTTTCAATGGATTTGCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.17

Weight (kDa)

9.65

Isoelectric Point (pI)

26.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 85
AfaI GTAC 2 cut(s) 26, 59
AgsI TTSAA 1 cut(s) 153
Alw26I GTCTC 1 cut(s) 75
Ama87I CYCGRG 1 cut(s) 112
ArsI GACNNNNNNTTYG 2 cut(s) 113, 145
AspS9I GGNCC 1 cut(s) 15
AsuHPI GGTGA 1 cut(s) 65
AvaI CYCGRG 1 cut(s) 112
AvaII GGWCC 1 cut(s) 15
BcoDI GTCTC 1 cut(s) 75
BfaI CTAG 1 cut(s) 89
Bme18I GGWCC 1 cut(s) 15
BmeT110I CYCGRG 1 cut(s) 112
BmgT120I GGNCC 1 cut(s) 15
BplI GAGNNNNNCTC 2 cut(s) 12, 44
BsaJI CCNNGG 1 cut(s) 28
BseDI CCNNGG 1 cut(s) 28
BsiHKCI CYCGRG 1 cut(s) 112
BsmAI GTCTC 1 cut(s) 75
BsoBI CYCGRG 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 28
BssNAI GTATAC 1 cut(s) 86
Bst1107I GTATAC 1 cut(s) 86
BstMAI GTCTC 1 cut(s) 75
BstZ17I GTATAC 1 cut(s) 86
Cfr13I GGNCC 1 cut(s) 15
Csp6I GTAC 2 cut(s) 25, 58
CviJI RGCY 2 cut(s) 33, 111
CviKI_1 RGCY 2 cut(s) 33, 111
CviQI GTAC 2 cut(s) 25, 58
Eco47I GGWCC 1 cut(s) 15
Eco88I CYCGRG 1 cut(s) 112
FaiI YATR 1 cut(s) 86
FalI AAGNNNNNCTT 2 cut(s) 44, 76
FblI GTMKAC 1 cut(s) 85
FspBI CTAG 1 cut(s) 89
HphI GGTGA 1 cut(s) 65
Hpy166II GTNNAC 2 cut(s) 25, 86
Hpy188III TCNNGA 3 cut(s) 18, 41, 103
Hpy8I GTNNAC 2 cut(s) 25, 86
HpyCH4V TGCA 1 cut(s) 119
LpnPI CCDG 2 cut(s) 31, 54
MaeI CTAG 1 cut(s) 89
MaeIII GTNAC 1 cut(s) 136
MnlI CCTC 1 cut(s) 38
NmeAIII GCCGAG 1 cut(s) 9
PspPI GGNCC 1 cut(s) 15
RsaI GTAC 2 cut(s) 26, 59
RsaNI GTAC 2 cut(s) 25, 58
Sau96I GGNCC 1 cut(s) 15
SetI ASST 3 cut(s) 17, 30, 81
SgeI CNNG 7 cut(s) 30, 41, 53, 101, 115, 124, 126
SinI GGWCC 1 cut(s) 15
SspMI CTAG 1 cut(s) 89
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 114
VpaK11BI GGWCC 1 cut(s) 15
XmiI GTMKAC 1 cut(s) 85
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.