RchiOBHm_Chr6g0281341

Component of the acetyl coenzyme A carboxylase (ACC) complex. Biotin carboxylase (BC) catalyzes the carboxylation of biotin on its carrier protein (BCCP) and then the CO(2) group is transferred by the transcarboxylase to acetyl-CoA to form malonyl- CoA

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
44637169 .. 44637393
225 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25234

Sequence Viewer

Length: 225 bp
ATGTTGGGAGATATCATTATTGCTAAACCCAACGCTTACATCGCATTTGTGGGTAAAAGAGTAATTGAACAAACATTGAATCAGGCAGTACCCAAGGATTCACAAGTGGTTGAATATTTATTCCATAAGGGCTTATTCGATCCAATCATACCATGTAATCCTTTAAAGGGCGTTCTGAGTGAATTATTTCGACTACATGCTTTCTTTCCTTTGAATCAAACTTAG
Functional Annotation

Protein Analysis

74

Amino Acids

8.34

Weight (kDa)

7.91

Isoelectric Point (pI)

29.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 134
AfaI GTAC 1 cut(s) 90
AfiI CCNNNNNNNGG 1 cut(s) 167
AgsI TTSAA 4 cut(s) 68, 79, 113, 214
AlwI GGATC 1 cut(s) 134
Asp700I GAANNNNTTC 1 cut(s) 186
BsaJI CCNNGG 1 cut(s) 93
Bsc4I CCNNNNNNNGG 1 cut(s) 167
BseDI CCNNGG 1 cut(s) 93
BseLI CCNNNNNNNGG 1 cut(s) 167
BseMII CTCAG 1 cut(s) 167
BslI CCNNNNNNNGG 1 cut(s) 167
Bsp143I GATC 1 cut(s) 139
BspCNI CTCAG 1 cut(s) 168
BspPI GGATC 1 cut(s) 134
BssECI CCNNGG 1 cut(s) 93
BssMI GATC 1 cut(s) 139
BssT1I CCWWGG 1 cut(s) 93
BstDEI CTNAG 2 cut(s) 176, 222
BstKTI GATC 1 cut(s) 142
BstMBI GATC 1 cut(s) 139
BstMWI GCNNNNNNNGC 1 cut(s) 41
BstNSI RCATGY 1 cut(s) 200
BtgZI GCGATG 1 cut(s) 25
Csp6I GTAC 1 cut(s) 89
CviAII CATG 2 cut(s) 153, 197
CviJI RGCY 1 cut(s) 132
CviKI_1 RGCY 1 cut(s) 132
CviQI GTAC 1 cut(s) 89
DdeI CTNAG 2 cut(s) 176, 222
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
DraI TTTAAA 1 cut(s) 165
Eco130I CCWWGG 1 cut(s) 93
Eco32I GATATC 1 cut(s) 13
EcoRV GATATC 1 cut(s) 13
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FaeI CATG 2 cut(s) 156, 200
FaiI YATR 4 cut(s) 126, 149, 154, 198
FatI CATG 2 cut(s) 152, 196
Hin1II CATG 2 cut(s) 156, 200
HinfI GANTC 3 cut(s) 79, 98, 214
Hpy188I TCNGA 1 cut(s) 177
HpyF10VI GCNNNNNNNGC 1 cut(s) 41
HpyF3I CTNAG 2 cut(s) 176, 222
Hsp92II CATG 2 cut(s) 156, 200
Kzo9I GATC 1 cut(s) 139
LpnPI CCDG 1 cut(s) 68
MalI GATC 1 cut(s) 141
MboI GATC 1 cut(s) 139
MluCI AATT 2 cut(s) 63, 182
MroXI GAANNNNTTC 1 cut(s) 186
MseI TTAA 1 cut(s) 164
MwoI GCNNNNNNNGC 1 cut(s) 41
NdeII GATC 1 cut(s) 139
NlaIII CATG 2 cut(s) 156, 200
NspI RCATGY 1 cut(s) 200
PdmI GAANNNNTTC 1 cut(s) 186
PfeI GAWTC 3 cut(s) 79, 98, 214
RsaI GTAC 1 cut(s) 90
RsaNI GTAC 1 cut(s) 89
SaqAI TTAA 1 cut(s) 164
Sau3AI GATC 1 cut(s) 139
SgeI CNNG 5 cut(s) 95, 106, 116, 165, 209
Sse9I AATT 2 cut(s) 63, 182
SspI AATATT 1 cut(s) 116
StyI CCWWGG 1 cut(s) 93
TaqI TCGA 2 cut(s) 138, 190
TasI AATT 2 cut(s) 63, 182
TfiI GAWTC 3 cut(s) 79, 98, 214
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
XceI RCATGY 1 cut(s) 200
XmnI GAANNNNTTC 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.