Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0009607

Physical Location & Seq

Genomic Coordinates Forward (+)

31523196 .. 31523414

Gene Structure 219 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ19175

Sequence Viewer

CDS Protein Promoter (2k)

Length: 219 bp

ATGGGGGCATTCATATCCAAGTTTTGGTTCATGTTGTTCCCTGTAAAAAAGAATAAGATTGTGGTAGTTGAGTTGGACAATGCTGGGAAGACGACTACCCCTTACAAATTACACTTGGGAAAGGCTATCACTACGAACCCGACTATAGGTAGCAAGATAGACCGAAGACTTCATGGAAAACACGCTACCGTGGAACTCATGCTATCATTGTGGCAATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Arf

Protein Analysis

72

Amino Acids

8.17

Weight (kDa)

10.17

Isoelectric Point (pI)

14.94

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Arf	PF00025	15 - 55	6.4e-09	ADP-ribosylation factor family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009607)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G22950 AT3G22950
fragaria_vesca	FvH4_4g01810
malus_domestica	MD13G1202300.v1.1 MD16G1202500.v1.1
prunus_persica	Prupe.1G024100_v2.0.a1 Prupe.1G024100_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0388851 RchiOBHm_Chr7g0214171 RchiOBHm_Chr7g0214281
rosa_laevigata	RLG00000002753 RLG00000010020
rosa_multiflora	Rmu_co8509249.1_g000002 Rmu_sc0000697.1_g000009 Rmu_sc0016023.1_g000006
rosa_roxburghii	Rroxscaffold_5G00335130
rosa_rugosa	Rorug03G0320500
rosa_samantha	Rh4AG025100 Rh4BG018200 Rh4CG028000 Rh4DG018800
rosa_wichuraiana	Rw4G001800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	24
AfiI	CCNNNNNNNGG	2 cut(s)	24, 146
AjuI	GAANNNNNNNTTGG	2 cut(s)	11, 43
BbsI	GAAGAC	2 cut(s)	95, 172
BfmI	CTRYAG	1 cut(s)	144
BpiI	GAAGAC	2 cut(s)	95, 172
BsaJI	CCNNGG	1 cut(s)	189
Bsc4I	CCNNNNNNNGG	2 cut(s)	24, 146
BseDI	CCNNGG	1 cut(s)	189
BseLI	CCNNNNNNNGG	2 cut(s)	24, 146
BseYI	CCCAGC	1 cut(s)	83
BslI	CCNNNNNNNGG	2 cut(s)	24, 146
BsmI	GAATGC	1 cut(s)	8
BssECI	CCNNGG	1 cut(s)	189
Bst4CI	ACNGT	1 cut(s)	190
BstDSI	CCRYGG	1 cut(s)	189
BstSFI	CTRYAG	1 cut(s)	144
BstV2I	GAAGAC	2 cut(s)	95, 172
BtgI	CCRYGG	1 cut(s)	189
CviAII	CATG	3 cut(s)	31, 173, 199
CviJI	RGCY	1 cut(s)	125
CviKI_1	RGCY	1 cut(s)	125
FaeI	CATG	3 cut(s)	34, 176, 202
FaiI	YATR	5 cut(s)	14, 32, 146, 174, 200
FatI	CATG	3 cut(s)	30, 172, 198
GsaI	CCCAGC	1 cut(s)	87
Hin1II	CATG	3 cut(s)	34, 176, 202
HpyCH4III	ACNGT	1 cut(s)	190
Hsp92II	CATG	3 cut(s)	34, 176, 202
LpnPI	CCDG	2 cut(s)	54, 69
MboII	GAAGA	2 cut(s)	100, 177
MluCI	AATT	1 cut(s)	107
MmeI	TCCRAC	1 cut(s)	54
Mva1269I	GAATGC	1 cut(s)	8
NlaIII	CATG	3 cut(s)	34, 176, 202
PctI	GAATGC	1 cut(s)	8
PflMI	CCANNNNNTGG	1 cut(s)	24
PspFI	CCCAGC	1 cut(s)	83
SetI	ASST	1 cut(s)	151
SfcI	CTRYAG	1 cut(s)	144
Sse9I	AATT	1 cut(s)	107
TaaI	ACNGT	1 cut(s)	190
TaqII	GACCGA	1 cut(s)	177
TasI	AATT	1 cut(s)	107
TspDTI	ATGAA	2 cut(s)	19, 161
Van91I	CCANNNNNTGG	1 cut(s)	24

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.