Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr1

Orthogroup ID

OG0009607

Physical Location & Seq

Genomic Coordinates Reverse (-)

39185548 .. 39185971

Gene Structure 424 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000002753

Sequence Viewer

CDS Protein Promoter (2k)

Length: 424 bp

ATGGGGGCATTCATGTCCAAGTTTTGGTTCATGTTGTTCTCTGCAAAAAAGAATAAGATTGTGGTAGTTGGGTTGGACAATGCTGGGAAGACGACTACCCCTTACAAATTACACTTGGGAGAGGTTGTCACTACGAACCCGACTATAGGCAGCTACTGTGGAACTCATGCTATCATTGTGGCAATAGACAACATAGAAAGTGCCAGAATTTCCATTATGAAGGACGCACTGATCATGTTGCTTGGACATGAGGATCTTCAACACTCAGTCATACTGGTTTTTGCTAATAAACAATATCTCAAGGATGCCATGATCCCAGCTGAGATCACTGACACTCTATCTCTTCACAACATTAAGAATCAAGATAGCACATCTAAGCATGATCTGCATTCAACAAGGATGGGTTGTATGATCAATGGCCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Arf

Protein Analysis

141

Amino Acids

15.56

Weight (kDa)

7.84

Isoelectric Point (pI)

31.46

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Arf	PF00025	11 - 51	3.9e-10	ADP-ribosylation factor family
Arf	PF00025	53 - 122	1.8e-13	ADP-ribosylation factor family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009607)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G22950 AT3G22950
fragaria_vesca	FvH4_4g01810
malus_domestica	MD13G1202300.v1.1 MD16G1202500.v1.1
prunus_persica	Prupe.1G024100_v2.0.a1 Prupe.1G024100_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0388851 RchiOBHm_Chr7g0214171 RchiOBHm_Chr7g0214281
rosa_laevigata	RLG00000002753 RLG00000010020
rosa_multiflora	Rmu_co8509249.1_g000002 Rmu_sc0000697.1_g000009 Rmu_sc0016023.1_g000006
rosa_roxburghii	Rroxscaffold_5G00335130
rosa_rugosa	Rorug03G0320500
rosa_samantha	Rh4AG025100 Rh4BG018200 Rh4CG028000 Rh4DG018800
rosa_wichuraiana	Rw4G001800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	24
AclWI	GGATC	2 cut(s)	261, 307
AcsI	RAATTY	1 cut(s)	207
AfiI	CCNNNNNNNGG	2 cut(s)	24, 146
AgsI	TTSAA	2 cut(s)	260, 393
AjuI	GAANNNNNNNTTGG	2 cut(s)	11, 43
AluBI	AGCT	2 cut(s)	153, 320
AluI	AGCT	2 cut(s)	153, 320
AlwI	GGATC	2 cut(s)	261, 307
AlwNI	CAGNNNCTG	1 cut(s)	156
AoxI	GGCC	1 cut(s)	418
ApeKI	GCWGC	1 cut(s)	150
ApoI	RAATTY	1 cut(s)	207
BbsI	GAAGAC	1 cut(s)	95
BbvI	GCAGC	1 cut(s)	162
BccI	CCATC	1 cut(s)	394
BclI	TGATCA	2 cut(s)	231, 411
BfaI	CTAG	1 cut(s)	422
BfmI	CTRYAG	1 cut(s)	144
BisI	GCNGC	1 cut(s)	151
BlsI	GCNGC	1 cut(s)	152
BmsI	GCATC	1 cut(s)	295
BpiI	GAAGAC	1 cut(s)	95
BpuEI	CTTGAG	1 cut(s)	284
BsaXI	ACNNNNNCTCC	2 cut(s)	111, 141
Bsc4I	CCNNNNNNNGG	2 cut(s)	24, 146
Bse1I	ACTGG	1 cut(s)	279
BseGI	GGATG	2 cut(s)	310, 405
BseLI	CCNNNNNNNGG	2 cut(s)	24, 146
BseMII	CTCAG	2 cut(s)	279, 312
BseNI	ACTGG	1 cut(s)	279
BseXI	GCAGC	1 cut(s)	162
BseYI	CCCAGC	2 cut(s)	83, 316
BshFI	GGCC	1 cut(s)	420
BslI	CCNNNNNNNGG	2 cut(s)	24, 146
BsmI	GAATGC	2 cut(s)	8, 388
BsnI	GGCC	1 cut(s)	420
Bsp143I	GATC	6 cut(s)	231, 253, 312, 324, 382, 411
BspANI	GGCC	1 cut(s)	420
BspCNI	CTCAG	2 cut(s)	278, 313
BspPI	GGATC	2 cut(s)	261, 307
BsrI	ACTGG	1 cut(s)	279
BssMI	GATC	6 cut(s)	231, 253, 312, 324, 382, 411
Bst4CI	ACNGT	1 cut(s)	158
Bst6I	CTCTTC	1 cut(s)	348
BstAPI	GCANNNNNTGC	1 cut(s)	385
BstDEI	CTNAG	3 cut(s)	265, 321, 375
BstF5I	GGATG	2 cut(s)	310, 405
BstKTI	GATC	6 cut(s)	234, 256, 315, 327, 385, 414
BstMBI	GATC	6 cut(s)	231, 253, 312, 324, 382, 411
BstMWI	GCNNNNNNNGC	1 cut(s)	385
BstSFI	CTRYAG	1 cut(s)	144
BstV1I	GCAGC	1 cut(s)	162
BstV2I	GAAGAC	1 cut(s)	95
BstX2I	RGATCY	1 cut(s)	253
BstYI	RGATCY	1 cut(s)	253
BsuRI	GGCC	1 cut(s)	420
BtsCI	GGATG	2 cut(s)	310, 405
BtsIMutI	CAGTG	2 cut(s)	227, 327
CaiI	CAGNNNCTG	1 cut(s)	156
CseI	GACGC	1 cut(s)	233
CviAII	CATG	7 cut(s)	13, 31, 167, 235, 248, 310, 380
CviJI	RGCY	3 cut(s)	153, 320, 420
CviKI_1	RGCY	3 cut(s)	153, 320, 420
DdeI	CTNAG	3 cut(s)	265, 321, 375
DpnI	GATC	6 cut(s)	233, 255, 314, 326, 384, 413
DpnII	GATC	6 cut(s)	231, 253, 312, 324, 382, 411
Eam1104I	CTCTTC	1 cut(s)	348
EarI	CTCTTC	1 cut(s)	348
FaeI	CATG	7 cut(s)	16, 34, 170, 238, 251, 313, 383
FatI	CATG	7 cut(s)	12, 30, 166, 234, 247, 309, 379
FbaI	TGATCA	2 cut(s)	231, 411
Fnu4HI	GCNGC	1 cut(s)	151
FokI	GGATG	2 cut(s)	317, 412
Fsp4HI	GCNGC	1 cut(s)	151
FspBI	CTAG	1 cut(s)	422
GluI	GCNGC	1 cut(s)	151
GsaI	CCCAGC	2 cut(s)	87, 320
HaeIII	GGCC	1 cut(s)	420
HgaI	GACGC	1 cut(s)	233
Hin1II	CATG	7 cut(s)	16, 34, 170, 238, 251, 313, 383
HinfI	GANTC	1 cut(s)	358
Hpy188III	TCNNGA	1 cut(s)	362
HpyAV	CCTTC	1 cut(s)	214
HpyCH4III	ACNGT	1 cut(s)	158
HpyCH4V	TGCA	2 cut(s)	44, 388
HpyF10VI	GCNNNNNNNGC	1 cut(s)	385
HpyF3I	CTNAG	3 cut(s)	265, 321, 375
Hsp92II	CATG	7 cut(s)	16, 34, 170, 238, 251, 313, 383
Ksp22I	TGATCA	2 cut(s)	231, 411
Kzo9I	GATC	6 cut(s)	231, 253, 312, 324, 382, 411
LpnPI	CCDG	4 cut(s)	69, 217, 260, 330
Lsp1109I	GCAGC	1 cut(s)	162
LweI	GCATC	1 cut(s)	295
MaeI	CTAG	1 cut(s)	422
MaeIII	GTNAC	1 cut(s)	127
MalI	GATC	6 cut(s)	233, 255, 314, 326, 384, 413
MboI	GATC	6 cut(s)	231, 253, 312, 324, 382, 411
MboII	GAAGA	3 cut(s)	100, 248, 335
MflI	RGATCY	1 cut(s)	253
MluCI	AATT	2 cut(s)	107, 207
MmeI	TCCRAC	1 cut(s)	54
MnlI	CCTC	2 cut(s)	115, 244
MseI	TTAA	1 cut(s)	354
MspA1I	CMGCKG	1 cut(s)	320
Mva1269I	GAATGC	2 cut(s)	8, 388
MwoI	GCNNNNNNNGC	1 cut(s)	385
NdeII	GATC	6 cut(s)	231, 253, 312, 324, 382, 411
NlaIII	CATG	7 cut(s)	16, 34, 170, 238, 251, 313, 383
NmuCI	GTSAC	1 cut(s)	127
PctI	GAATGC	2 cut(s)	8, 388
PfeI	GAWTC	1 cut(s)	358
PflMI	CCANNNNNTGG	1 cut(s)	24
PkrI	GCNGC	1 cut(s)	152
PspFI	CCCAGC	2 cut(s)	83, 316
PstNI	CAGNNNCTG	1 cut(s)	156
PsuI	RGATCY	1 cut(s)	253
PvuII	CAGCTG	1 cut(s)	320
SaqAI	TTAA	1 cut(s)	354
SatI	GCNGC	1 cut(s)	151
Sau3AI	GATC	6 cut(s)	231, 253, 312, 324, 382, 411
SetI	ASST	3 cut(s)	126, 155, 322
SfaNI	GCATC	1 cut(s)	295
SfcI	CTRYAG	1 cut(s)	144
SmlI	CTYRAG	1 cut(s)	299
SmoI	CTYRAG	1 cut(s)	299
Sse9I	AATT	2 cut(s)	107, 207
SspMI	CTAG	1 cut(s)	422
TaaI	ACNGT	1 cut(s)	158
TasI	AATT	2 cut(s)	107, 207
TfiI	GAWTC	1 cut(s)	358
Tru1I	TTAA	1 cut(s)	354
Tru9I	TTAA	1 cut(s)	354
TscAI	CASTG	2 cut(s)	234, 334
TseFI	GTSAC	1 cut(s)	127
TseI	GCWGC	1 cut(s)	150
Tsp45I	GTSAC	1 cut(s)	127
TspDTI	ATGAA	2 cut(s)	19, 233
TspRI	CASTG	2 cut(s)	234, 334
Van91I	CCANNNNNTGG	1 cut(s)	24
XapI	RAATTY	1 cut(s)	207
XspI	CTAG	1 cut(s)	422

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.