RLG00000007409

ER membrane protein complex subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
OG0017321
Physical Location & Seq
Reverse (-)
16535652 .. 16537299
1648 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000007409

Sequence Viewer

Length: 468 bp
ATGGACTGCCAGTGTCTTGATGTTGCAAAGCTAGAGGATATGTTGCTTGAGGCAAAGGGATCCTGGGTAGAGGCAGAGAGAGCTTATCTAATATGTAAATTTCAATCTATCCTTCTTTTGCAGGTAATACATAAGGTTGTTGACTTGTCTTTTCCCTCTGTTTACAGATTTATGGCCGTTAATGATGCCTGGAGAGAGCTGGCAAAAATCTATGTCTCATTGCAAATGTATGTTTCTACAGACTTAAGGAAGTTTACTGACATTGGCACAACCTACCGCTTAGCATATGCTGATATTCCTCGGTGGATTAGAAAACATACAGACAACAAAGAAATACTACGCATCTGTTATAGAATTAACTGGGGGCAAGAATATCAGAGCACTTTTGGTATTAACTTGTGTACTTCTGCCATTGCACAGCTTGCGATAGGAAGGAACAAGGAGAGCTTGGAGCAATGTTGTAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TPR_16 TPR_19

Protein Analysis

156

Amino Acids

18.03

Weight (kDa)

7.54

Isoelectric Point (pI)

37.79

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPR_EMC2 PF22890 9 - 106 4.5e-10 EMC2 TPR-like repeat domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017321)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g03340
rosa_chinensis RchiOBHm_Chr5g0051541 RchiOBHm_Chr6g0244381 RchiOBHm_Chr7g0229041
rosa_laevigata RLG00000003551 RLG00000007409
rosa_multiflora Rmu_co8186706.1_g000001 Rmu_co8442279.1_g000001
rosa_roxburghii Rroxscaffold_7G00158180
rosa_rugosa Rorug05G0508200
rosa_samantha Rh6AG023300 Rh7DG291700
rosa_wichuraiana Rw2G024010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 112
AciI CCGC 1 cut(s) 277
AclWI GGATC 2 cut(s) 54, 67
AcoI YGGCCR 1 cut(s) 174
AcsI RAATTY 1 cut(s) 98
AfaI GTAC 1 cut(s) 403
AflII CTTAAG 1 cut(s) 244
AgsI TTSAA 1 cut(s) 104
AjnI CCWGG 2 cut(s) 62, 188
AluBI AGCT 5 cut(s) 31, 83, 199, 421, 447
AluI AGCT 5 cut(s) 31, 83, 199, 421, 447
Alw21I GWGCWC 1 cut(s) 383
Alw26I GTCTC 1 cut(s) 220
AlwI GGATC 2 cut(s) 54, 67
AoxI GGCC 1 cut(s) 174
ApoI RAATTY 1 cut(s) 98
BamHI GGATCC 1 cut(s) 59
Bbv12I GWGCWC 1 cut(s) 383
BceAI ACGGC 1 cut(s) 161
BciT130I CCWGG 2 cut(s) 64, 190
BcoDI GTCTC 1 cut(s) 220
BfaI CTAG 1 cut(s) 32
BfmI CTRYAG 1 cut(s) 237
BfrI CTTAAG 1 cut(s) 244
BfuAI ACCTGC 1 cut(s) 112
BlpI GCTNAGC 1 cut(s) 280
Bme1390I CCNGG 2 cut(s) 64, 190
BmiI GGNNCC 1 cut(s) 61
BmrFI CCNGG 2 cut(s) 64, 190
BmrI ACTGGG 1 cut(s) 370
BmsI GCATC 2 cut(s) 175, 351
BmuI ACTGGG 1 cut(s) 370
BpmI CTGGAG 1 cut(s) 211
Bpu1102I GCTNAGC 1 cut(s) 280
BpuEI CTTGAG 1 cut(s) 68
BsaJI CCNNGG 2 cut(s) 63, 299
Bse1I ACTGG 2 cut(s) 10, 365
Bse3DI GCAATG 3 cut(s) 218, 411, 461
BseBI CCWGG 2 cut(s) 64, 190
BseDI CCNNGG 2 cut(s) 63, 299
BseMI GCAATG 3 cut(s) 218, 411, 461
BseNI ACTGG 2 cut(s) 10, 365
BshFI GGCC 1 cut(s) 176
BsiHKAI GWGCWC 1 cut(s) 383
BsmAI GTCTC 1 cut(s) 220
BsnI GGCC 1 cut(s) 176
Bsp1286I GDGCHC 1 cut(s) 383
Bsp143I GATC 1 cut(s) 59
Bsp1720I GCTNAGC 1 cut(s) 280
BspACI CCGC 1 cut(s) 277
BspANI GGCC 1 cut(s) 176
BspLI GGNNCC 1 cut(s) 61
BspMI ACCTGC 1 cut(s) 112
BspPI GGATC 2 cut(s) 54, 67
BspTI CTTAAG 1 cut(s) 244
BsrDI GCAATG 3 cut(s) 218, 411, 461
BsrI ACTGG 2 cut(s) 10, 365
BssECI CCNNGG 2 cut(s) 63, 299
BssMI GATC 1 cut(s) 59
Bst2UI CCWGG 2 cut(s) 64, 190
BstAFI CTTAAG 1 cut(s) 244
BstAPI GCANNNNNTGC 1 cut(s) 422
BstC8I GCNNGC 2 cut(s) 201, 423
BstDEI CTNAG 1 cut(s) 280
BstKTI GATC 1 cut(s) 62
BstMAI GTCTC 1 cut(s) 220
BstMBI GATC 1 cut(s) 59
BstMWI GCNNNNNNNGC 2 cut(s) 80, 422
BstNI CCWGG 2 cut(s) 64, 190
BstSCI CCNGG 2 cut(s) 62, 188
BstSFI CTRYAG 1 cut(s) 237
BstX2I RGATCY 1 cut(s) 59
BstYI RGATCY 1 cut(s) 59
BsuRI GGCC 1 cut(s) 176
BtsIMutI CAGTG 1 cut(s) 17
BveI ACCTGC 1 cut(s) 112
Cac8I GCNNGC 2 cut(s) 201, 423
Csp6I GTAC 1 cut(s) 402
CviJI RGCY 6 cut(s) 31, 83, 176, 199, 421, 447
CviKI_1 RGCY 6 cut(s) 31, 83, 176, 199, 421, 447
CviQI GTAC 1 cut(s) 402
DdeI CTNAG 1 cut(s) 280
DpnI GATC 1 cut(s) 61
DpnII GATC 1 cut(s) 59
EaeI YGGCCR 1 cut(s) 174
EcoRII CCWGG 2 cut(s) 62, 188
FalI AAGNNNNNCTT 2 cut(s) 431, 463
FauNDI CATATG 1 cut(s) 286
FspBI CTAG 1 cut(s) 32
GsuI CTGGAG 1 cut(s) 211
HaeIII GGCC 1 cut(s) 176
HincII GTYRAC 1 cut(s) 142
HindII GTYRAC 1 cut(s) 142
Hpy166II GTNNAC 4 cut(s) 142, 163, 255, 402
Hpy188I TCNGA 1 cut(s) 378
Hpy188III TCNNGA 1 cut(s) 17
Hpy8I GTNNAC 4 cut(s) 142, 163, 255, 402
HpyAV CCTTC 2 cut(s) 122, 426
HpyCH4V TGCA 4 cut(s) 26, 121, 223, 416
HpyF10VI GCNNNNNNNGC 2 cut(s) 80, 422
HpyF3I CTNAG 1 cut(s) 280
Kzo9I GATC 1 cut(s) 59
LmnI GCTCC 1 cut(s) 451
LpnPI CCDG 8 cut(s) 23, 49, 76, 107, 175, 185, 202, 346
LweI GCATC 2 cut(s) 175, 351
MaeI CTAG 1 cut(s) 32
MalI GATC 1 cut(s) 61
MboI GATC 1 cut(s) 59
MflI RGATCY 1 cut(s) 59
MhlI GDGCHC 1 cut(s) 383
MluCI AATT 2 cut(s) 98, 354
MnlI CCTC 5 cut(s) 28, 43, 64, 166, 309
MseI TTAA 4 cut(s) 180, 245, 357, 393
MspCI CTTAAG 1 cut(s) 244
MspR9I CCNGG 2 cut(s) 64, 190
MvaI CCWGG 2 cut(s) 64, 190
MwoI GCNNNNNNNGC 2 cut(s) 80, 422
NdeI CATATG 1 cut(s) 286
NdeII GATC 1 cut(s) 59
NlaIV GGNNCC 1 cut(s) 61
Psp6I CCWGG 2 cut(s) 62, 188
PspGI CCWGG 2 cut(s) 62, 188
PspN4I GGNNCC 1 cut(s) 61
PsuI RGATCY 1 cut(s) 59
RsaI GTAC 1 cut(s) 403
RsaNI GTAC 1 cut(s) 402
SaqAI TTAA 4 cut(s) 180, 245, 357, 393
Sau3AI GATC 1 cut(s) 59
ScrFI CCNGG 2 cut(s) 64, 190
SduI GDGCHC 1 cut(s) 383
SetI ASST 8 cut(s) 33, 85, 126, 138, 201, 275, 423, 449
SfaNI GCATC 2 cut(s) 175, 351
SfcI CTRYAG 1 cut(s) 237
SmlI CTYRAG 2 cut(s) 47, 244
SmoI CTYRAG 2 cut(s) 47, 244
Sse9I AATT 2 cut(s) 98, 354
SsiI CCGC 1 cut(s) 277
SspMI CTAG 1 cut(s) 32
StyD4I CCNGG 2 cut(s) 62, 188
TasI AATT 2 cut(s) 98, 354
TatI WGTACW 1 cut(s) 401
Tru1I TTAA 4 cut(s) 180, 245, 357, 393
Tru9I TTAA 4 cut(s) 180, 245, 357, 393
TscAI CASTG 1 cut(s) 17
TspRI CASTG 1 cut(s) 17
Vha464I CTTAAG 1 cut(s) 244
XapI RAATTY 1 cut(s) 98
XspI CTAG 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.