RLG00000008100

Paired amphipathic helix protein Sin3-like

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
Physical Location & Seq
Reverse (-)
25603243 .. 25603998
756 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000008100

Sequence Viewer

Length: 366 bp
ATGAAAACCAACCTAATCGGAGACACCTACATCCGCATATCAAATTCAGAAGAAAGTGAGAAGAAGCCCGGAATTGCAGTGAAAGAATTCAAGCGTGTGCAGGAGAAATCCAGAAAGAGAATGATCAAAAGAGGGTTTTATTTCTGCGACAAAGTTCAGGATATTCTTAAAGATTCAGATAAGTATCTTGAATTTCTAAAGCAACTCTACATGTATAGCGAGGGAGTTCTAGATTTGACTGAGTTTCTAAACTTAGTTGATGATAAGGGAGTTCTGGACTTGACGGAGTTTCTGAACATGATGGATGACTATGTTCGAGCCAATGAAAATCTCGTGAGCGACTTGGATGATTTTCTCGAGCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

14.34

Weight (kDa)

4.85

Isoelectric Point (pI)

35.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 34
AcsI RAATTY 3 cut(s) 43, 86, 191
AflIII ACRYGT 1 cut(s) 210
AgsI TTSAA 2 cut(s) 91, 191
Alw21I GWGCWC 1 cut(s) 363
Alw26I GTCTC 1 cut(s) 15
Ama87I CYCGRG 1 cut(s) 356
ApoI RAATTY 3 cut(s) 43, 86, 191
Asp700I GAANNNNTTC 1 cut(s) 86
AsuC2I CCSGG 1 cut(s) 69
AvaI CYCGRG 1 cut(s) 356
BauI CACGAG 1 cut(s) 332
Bbv12I GWGCWC 1 cut(s) 363
BccI CCATC 1 cut(s) 295
BclI TGATCA 1 cut(s) 123
BcnI CCSGG 1 cut(s) 69
BcoDI GTCTC 1 cut(s) 15
BfaI CTAG 2 cut(s) 230, 364
Bme1390I CCNGG 1 cut(s) 69
BmeT110I CYCGRG 1 cut(s) 356
BmrFI CCNGG 1 cut(s) 69
BpuMI CCSGG 1 cut(s) 69
BsaBI GATNNNNATC 1 cut(s) 183
Bse8I GATNNNNATC 1 cut(s) 183
BseGI GGATG 3 cut(s) 30, 310, 352
BseJI GATNNNNATC 1 cut(s) 183
BseMII CTCAG 1 cut(s) 231
BsgI GTGCAG 1 cut(s) 119
BsiHKAI GWGCWC 1 cut(s) 363
BsiHKCI CYCGRG 1 cut(s) 356
BsiSI CCGG 1 cut(s) 69
BsmAI GTCTC 1 cut(s) 15
BsoBI CYCGRG 1 cut(s) 356
Bsp1286I GDGCHC 1 cut(s) 363
Bsp143I GATC 1 cut(s) 123
BspACI CCGC 1 cut(s) 34
BspCNI CTCAG 1 cut(s) 232
BssMI GATC 1 cut(s) 123
BssSI CACGAG 1 cut(s) 332
Bst2BI CACGAG 1 cut(s) 332
BstDEI CTNAG 2 cut(s) 240, 253
BstF5I GGATG 3 cut(s) 30, 310, 352
BstKTI GATC 1 cut(s) 126
BstMAI GTCTC 1 cut(s) 15
BstMBI GATC 1 cut(s) 123
BstNSI RCATGY 1 cut(s) 214
BstSCI CCNGG 1 cut(s) 67
BtsCI GGATG 3 cut(s) 30, 310, 352
BtsI GCAGTG 1 cut(s) 84
BtsIMutI CAGTG 1 cut(s) 84
CviAII CATG 2 cut(s) 211, 298
CviJI RGCY 2 cut(s) 67, 320
CviKI_1 RGCY 2 cut(s) 67, 320
DdeI CTNAG 2 cut(s) 240, 253
DpnI GATC 1 cut(s) 125
DpnII GATC 1 cut(s) 123
Eco88I CYCGRG 1 cut(s) 356
EcoRI GAATTC 1 cut(s) 86
FaeI CATG 2 cut(s) 214, 301
FaiI YATR 5 cut(s) 38, 212, 216, 299, 312
FatI CATG 2 cut(s) 210, 297
FbaI TGATCA 1 cut(s) 123
FokI GGATG 3 cut(s) 17, 317, 359
FspBI CTAG 2 cut(s) 230, 364
HapII CCGG 1 cut(s) 69
Hin1II CATG 2 cut(s) 214, 301
HinfI GANTC 1 cut(s) 173
HpaII CCGG 1 cut(s) 69
Hpy188I TCNGA 4 cut(s) 20, 49, 178, 294
Hpy188III TCNNGA 7 cut(s) 111, 158, 188, 230, 275, 334, 356
HpyCH4V TGCA 2 cut(s) 77, 100
HpyF3I CTNAG 2 cut(s) 240, 253
Hsp92II CATG 2 cut(s) 214, 301
Ksp22I TGATCA 1 cut(s) 123
Kzo9I GATC 1 cut(s) 123
LpnPI CCDG 5 cut(s) 82, 86, 124, 143, 260
MaeI CTAG 2 cut(s) 230, 364
MalI GATC 1 cut(s) 125
MboI GATC 1 cut(s) 123
MboII GAAGA 2 cut(s) 62, 73
MhlI GDGCHC 1 cut(s) 363
MluCI AATT 4 cut(s) 43, 72, 86, 191
MnlI CCTC 2 cut(s) 125, 214
MroXI GAANNNNTTC 1 cut(s) 86
MseI TTAA 1 cut(s) 168
MspI CCGG 1 cut(s) 69
MspR9I CCNGG 1 cut(s) 69
NciI CCSGG 1 cut(s) 69
NdeII GATC 1 cut(s) 123
NlaIII CATG 2 cut(s) 214, 301
NspI RCATGY 1 cut(s) 214
PaeR7I CTCGAG 1 cut(s) 356
PciI ACATGT 1 cut(s) 210
PdmI GAANNNNTTC 1 cut(s) 86
PfeI GAWTC 1 cut(s) 173
PscI ACATGT 1 cut(s) 210
SaqAI TTAA 1 cut(s) 168
Sau3AI GATC 1 cut(s) 123
ScrFI CCNGG 1 cut(s) 69
SduI GDGCHC 1 cut(s) 363
SetI ASST 2 cut(s) 15, 29
Sfr274I CTCGAG 1 cut(s) 356
SlaI CTCGAG 1 cut(s) 356
SmlI CTYRAG 1 cut(s) 356
SmoI CTYRAG 1 cut(s) 356
Sse9I AATT 4 cut(s) 43, 72, 86, 191
SsiI CCGC 1 cut(s) 34
SspMI CTAG 2 cut(s) 230, 364
StyD4I CCNGG 1 cut(s) 67
TaqI TCGA 2 cut(s) 316, 357
TasI AATT 4 cut(s) 43, 72, 86, 191
TfiI GAWTC 1 cut(s) 173
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TscAI CASTG 1 cut(s) 84
TspDTI ATGAA 2 cut(s) 17, 339
TspGWI ACGGA 1 cut(s) 299
TspRI CASTG 1 cut(s) 84
XapI RAATTY 3 cut(s) 43, 86, 191
XbaI TCTAGA 1 cut(s) 229
XceI RCATGY 1 cut(s) 214
XhoI CTCGAG 1 cut(s) 356
XmnI GAANNNNTTC 1 cut(s) 86
XspI CTAG 2 cut(s) 230, 364
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.