Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008157.1

Orthogroup ID

OG0007501

Physical Location & Seq

Genomic Coordinates Forward (+)

33709 .. 34080

Gene Structure 372 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008157.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 372 bp

atgaaaaccaacctaatcggagacaccttcatccgcatatcaaattcagaagaaagtgagaagaagcccagaattgcagtgaaagaattcaagcgtgtgcaggagaaatccagaaagagaatgatcaaaagaggtttttatttctgtgacaaagttcaggatattcttaaagattcagataagtatcttgaatttctaaagcaactgcacatgtatagcaagggagttctagatttgactgagtttctaaacttagttgatgataaggttcgagaaaacgaacgtctcatgtttagattcgatgattttttggagagatgtgaggaatcggggaacagagctgacttgatatctctatgcaaatccagttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04139 ko04919 ko05016 ko05202 map04139 map04919 map05016 map05202

Pfam Domains

Protein Families

PAH Sin3_corepress Sin3a_C

Protein Analysis

123

Amino Acids

14.71

Weight (kDa)

8.74

Isoelectric Point (pI)

35.22

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007501)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g13800
malus_domestica	MD04G1010500.v1.1
prunus_persica	Prupe.1G010200_v2.0.a1
pyrus_communis	pycom04g00860
rosa_chinensis	RchiOBHm_Chr4g0414721
rosa_laevigata	RLG00000008100 RLG00000008121
rosa_multiflora	Rmu_sc0001192.1_g000028 Rmu_sc0003611.1_g000015 Rmu_sc0008157.1_g000009 Rmu_sc0010606.1_g000009
rosa_roxburghii	Rroxscaffold_5G00358530 Rroxscaffold_5G00358820
rosa_rugosa	Rorug04G0130200 Rorug04G0130200 Rorug04G0132000
rosa_samantha	Rh4AG188500 Rh4AG191300 Rh4BG187500 Rh4BG189400 Rh4CG200800 Rh4CG202200 Rh4DG187100 Rh4DG189800
rosa_wichuraiana	Rw4G016080

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	34
AcsI	RAATTY	3 cut(s)	43, 86, 191
AflIII	ACRYGT	1 cut(s)	210
AgsI	TTSAA	2 cut(s)	91, 191
AluBI	AGCT	1 cut(s)	341
AluI	AGCT	1 cut(s)	341
Alw26I	GTCTC	2 cut(s)	15, 290
ApoI	RAATTY	3 cut(s)	43, 86, 191
Asp700I	GAANNNNTTC	1 cut(s)	86
BclI	TGATCA	1 cut(s)	123
BcoDI	GTCTC	2 cut(s)	15, 290
BfaI	CTAG	1 cut(s)	230
BsaBI	GATNNNNATC	1 cut(s)	183
Bse1I	ACTGG	1 cut(s)	366
Bse8I	GATNNNNATC	1 cut(s)	183
BseGI	GGATG	1 cut(s)	30
BseJI	GATNNNNATC	1 cut(s)	183
BseMII	CTCAG	1 cut(s)	231
BseNI	ACTGG	1 cut(s)	366
BsgI	GTGCAG	2 cut(s)	119, 191
BsmAI	GTCTC	2 cut(s)	15, 290
BsmBI	CGTCTC	1 cut(s)	290
Bsp143I	GATC	1 cut(s)	123
BspACI	CCGC	1 cut(s)	34
BspCNI	CTCAG	1 cut(s)	232
BsrI	ACTGG	1 cut(s)	366
BssMI	GATC	1 cut(s)	123
BstDEI	CTNAG	2 cut(s)	240, 253
BstF5I	GGATG	1 cut(s)	30
BstKTI	GATC	1 cut(s)	126
BstMAI	GTCTC	2 cut(s)	15, 290
BstMBI	GATC	1 cut(s)	123
BstNSI	RCATGY	1 cut(s)	214
BtsCI	GGATG	1 cut(s)	30
BtsI	GCAGTG	1 cut(s)	84
BtsIMutI	CAGTG	1 cut(s)	84
CviAII	CATG	2 cut(s)	211, 289
CviJI	RGCY	2 cut(s)	67, 341
CviKI_1	RGCY	2 cut(s)	67, 341
DdeI	CTNAG	2 cut(s)	240, 253
DpnI	GATC	1 cut(s)	125
DpnII	GATC	1 cut(s)	123
Eco32I	GATATC	1 cut(s)	351
EcoRI	GAATTC	1 cut(s)	86
EcoRV	GATATC	1 cut(s)	351
Esp3I	CGTCTC	1 cut(s)	290
FaeI	CATG	2 cut(s)	214, 292
FaiI	YATR	5 cut(s)	38, 212, 216, 290, 358
FatI	CATG	2 cut(s)	210, 288
FbaI	TGATCA	1 cut(s)	123
FokI	GGATG	1 cut(s)	17
FspBI	CTAG	1 cut(s)	230
Hin1II	CATG	2 cut(s)	214, 292
HinfI	GANTC	3 cut(s)	173, 297, 326
Hpy188I	TCNGA	3 cut(s)	20, 49, 178
Hpy188III	TCNNGA	5 cut(s)	111, 158, 188, 230, 272
HpyAV	CCTTC	1 cut(s)	37
HpyCH4IV	ACGT	1 cut(s)	283
HpyCH4V	TGCA	4 cut(s)	77, 100, 208, 360
HpyF3I	CTNAG	2 cut(s)	240, 253
HpySE526I	ACGT	1 cut(s)	283
Hsp92II	CATG	2 cut(s)	214, 292
Ksp22I	TGATCA	1 cut(s)	123
Kzo9I	GATC	1 cut(s)	123
LpnPI	CCDG	4 cut(s)	82, 86, 124, 143
MaeI	CTAG	1 cut(s)	230
MaeII	ACGT	1 cut(s)	283
MaeIII	GTNAC	1 cut(s)	146
MalI	GATC	1 cut(s)	125
MboI	GATC	1 cut(s)	123
MboII	GAAGA	2 cut(s)	62, 73
MluCI	AATT	4 cut(s)	43, 72, 86, 191
MnlI	CCTC	2 cut(s)	125, 316
MroXI	GAANNNNTTC	1 cut(s)	86
MseI	TTAA	1 cut(s)	168
NdeII	GATC	1 cut(s)	123
NlaIII	CATG	2 cut(s)	214, 292
NmuCI	GTSAC	1 cut(s)	146
NspI	RCATGY	1 cut(s)	214
PciI	ACATGT	1 cut(s)	210
PdmI	GAANNNNTTC	1 cut(s)	86
PfeI	GAWTC	3 cut(s)	173, 297, 326
PscI	ACATGT	1 cut(s)	210
SaqAI	TTAA	1 cut(s)	168
Sau3AI	GATC	1 cut(s)	123
SetI	ASST	6 cut(s)	15, 29, 136, 270, 286, 343
Sse9I	AATT	4 cut(s)	43, 72, 86, 191
SsiI	CCGC	1 cut(s)	34
SspMI	CTAG	1 cut(s)	230
TaiI	ACGT	1 cut(s)	286
TaqI	TCGA	2 cut(s)	271, 300
TasI	AATT	4 cut(s)	43, 72, 86, 191
TfiI	GAWTC	3 cut(s)	173, 297, 326
Tru1I	TTAA	1 cut(s)	168
Tru9I	TTAA	1 cut(s)	168
TscAI	CASTG	1 cut(s)	84
TseFI	GTSAC	1 cut(s)	146
Tsp45I	GTSAC	1 cut(s)	146
TspDTI	ATGAA	2 cut(s)	17, 19
TspRI	CASTG	1 cut(s)	84
XapI	RAATTY	3 cut(s)	43, 86, 191
XbaI	TCTAGA	1 cut(s)	229
XceI	RCATGY	1 cut(s)	214
XmnI	GAANNNNTTC	1 cut(s)	86
XspI	CTAG	1 cut(s)	230

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.