Rroxscaffold_5G00358820

Paired amphipathic helix protein Sin3-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
38927966 .. 38928337
372 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00358820.1

Sequence Viewer

Length: 372 bp
ATGAAAACCAACCTAATCGGAGACACCTTCATCCGCATACCAAATTCAGAAGAAAGTGAGAAGAAGCCCAGAATTGCCGTGAAAGAATTCAAGCGTGTACAGGAGAAATCCAAAAAGAGAATGATCAAAAGAGGGTTCTATTTCTGCGACAAAGTTCAGGATATTCTTAAAGATTCAGATAAGTATCTTGAATTTCTAAAGCAACTCTGCATGTATAGCAAGGGAGTTCTAGATTTGACTGAGTTTCTAAACTTGGTTGATGATAAGGTTCGAGAAAACGAACGTCTCATGTTTAGATTCGATGATTTTTTGGAGAGATGTGAGGAATCAGGGAACAGACCTGACTTGAGATCTCTATGCAAATCCAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

14.73

Weight (kDa)

8.87

Isoelectric Point (pI)

42.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 34
AcsI RAATTY 3 cut(s) 43, 86, 191
AfaI GTAC 1 cut(s) 99
AgsI TTSAA 2 cut(s) 91, 191
Alw26I GTCTC 2 cut(s) 15, 290
ApoI RAATTY 3 cut(s) 43, 86, 191
Asp700I GAANNNNTTC 1 cut(s) 86
BceAI ACGGC 1 cut(s) 62
BclI TGATCA 1 cut(s) 123
BcoDI GTCTC 2 cut(s) 15, 290
BfaI CTAG 1 cut(s) 230
BglII AGATCT 1 cut(s) 350
BpuEI CTTGAG 1 cut(s) 367
BsaBI GATNNNNATC 1 cut(s) 183
Bse1I ACTGG 1 cut(s) 366
Bse8I GATNNNNATC 1 cut(s) 183
BseGI GGATG 1 cut(s) 30
BseJI GATNNNNATC 1 cut(s) 183
BseMII CTCAG 1 cut(s) 231
BseNI ACTGG 1 cut(s) 366
BsmAI GTCTC 2 cut(s) 15, 290
BsmBI CGTCTC 1 cut(s) 290
Bsp1407I TGTACA 1 cut(s) 97
Bsp143I GATC 2 cut(s) 123, 350
BspACI CCGC 1 cut(s) 34
BspCNI CTCAG 1 cut(s) 232
BsrGI TGTACA 1 cut(s) 97
BsrI ACTGG 1 cut(s) 366
BssMI GATC 2 cut(s) 123, 350
BstAUI TGTACA 1 cut(s) 97
BstDEI CTNAG 1 cut(s) 240
BstF5I GGATG 1 cut(s) 30
BstKTI GATC 2 cut(s) 126, 353
BstMAI GTCTC 2 cut(s) 15, 290
BstMBI GATC 2 cut(s) 123, 350
BstMWI GCNNNNNNNGC 1 cut(s) 216
BstNSI RCATGY 1 cut(s) 214
BstX2I RGATCY 1 cut(s) 350
BstYI RGATCY 1 cut(s) 350
BtsCI GGATG 1 cut(s) 30
Csp6I GTAC 1 cut(s) 98
CviAII CATG 2 cut(s) 211, 289
CviJI RGCY 1 cut(s) 67
CviKI_1 RGCY 1 cut(s) 67
CviQI GTAC 1 cut(s) 98
DdeI CTNAG 1 cut(s) 240
DpnI GATC 2 cut(s) 125, 352
DpnII GATC 2 cut(s) 123, 350
EcoRI GAATTC 1 cut(s) 86
Esp3I CGTCTC 1 cut(s) 290
FaeI CATG 2 cut(s) 214, 292
FaiI YATR 5 cut(s) 38, 212, 216, 290, 358
FatI CATG 2 cut(s) 210, 288
FbaI TGATCA 1 cut(s) 123
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 230
Hin1II CATG 2 cut(s) 214, 292
HinfI GANTC 3 cut(s) 173, 297, 326
Hpy166II GTNNAC 1 cut(s) 98
Hpy188I TCNGA 3 cut(s) 20, 49, 178
Hpy188III TCNNGA 4 cut(s) 158, 188, 230, 272
Hpy8I GTNNAC 1 cut(s) 98
HpyAV CCTTC 1 cut(s) 37
HpyCH4IV ACGT 1 cut(s) 283
HpyCH4V TGCA 2 cut(s) 210, 360
HpyF10VI GCNNNNNNNGC 1 cut(s) 216
HpyF3I CTNAG 1 cut(s) 240
HpySE526I ACGT 1 cut(s) 283
Hsp92II CATG 2 cut(s) 214, 292
Ksp22I TGATCA 1 cut(s) 123
Kzo9I GATC 2 cut(s) 123, 350
LpnPI CCDG 5 cut(s) 82, 86, 143, 315, 354
MaeI CTAG 1 cut(s) 230
MaeII ACGT 1 cut(s) 283
MalI GATC 2 cut(s) 125, 352
MboI GATC 2 cut(s) 123, 350
MboII GAAGA 2 cut(s) 62, 73
MflI RGATCY 1 cut(s) 350
MluCI AATT 4 cut(s) 43, 72, 86, 191
MnlI CCTC 2 cut(s) 125, 316
MroXI GAANNNNTTC 1 cut(s) 86
MseI TTAA 1 cut(s) 168
MwoI GCNNNNNNNGC 1 cut(s) 216
NdeII GATC 2 cut(s) 123, 350
NlaIII CATG 2 cut(s) 214, 292
NspI RCATGY 1 cut(s) 214
PdmI GAANNNNTTC 1 cut(s) 86
PfeI GAWTC 3 cut(s) 173, 297, 326
PsuI RGATCY 1 cut(s) 350
RsaI GTAC 1 cut(s) 99
RsaNI GTAC 1 cut(s) 98
SaqAI TTAA 1 cut(s) 168
Sau3AI GATC 2 cut(s) 123, 350
SetI ASST 5 cut(s) 15, 29, 270, 286, 343
SmlI CTYRAG 1 cut(s) 346
SmoI CTYRAG 1 cut(s) 346
Sse9I AATT 4 cut(s) 43, 72, 86, 191
SsiI CCGC 1 cut(s) 34
SspMI CTAG 1 cut(s) 230
TaiI ACGT 1 cut(s) 286
TaqI TCGA 2 cut(s) 271, 300
TasI AATT 4 cut(s) 43, 72, 86, 191
TatI WGTACW 1 cut(s) 97
TfiI GAWTC 3 cut(s) 173, 297, 326
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TspDTI ATGAA 2 cut(s) 17, 19
XapI RAATTY 3 cut(s) 43, 86, 191
XbaI TCTAGA 1 cut(s) 229
XceI RCATGY 1 cut(s) 214
XmnI GAANNNNTTC 1 cut(s) 86
XspI CTAG 1 cut(s) 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.