RLG00000027970

Catalyzes the ATP-dependent amination of UTP to CTP with either L-glutamine or ammonia as the source of nitrogen

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Reverse (-)
17340989 .. 17342442
1454 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000027970

Sequence Viewer

Length: 375 bp
ATGGAGATGAGCTGCCAGTCGAATGGCAATTCTACTGACATTCAACAGCTCTGTAACTCTGGGGGGACCTCATACCAGGACAAGACTTACTCAGGCTATATGCCTCCTCCTCCTTTTGTTGATTTAGACCTGGGTAACTACGAGCGGTTCGTAGATGTGACTCTTACTAGGGACAACAATGTTACGACGGGCAAGATATATCAGTCTGTCTATGACAAGGAGCGGAGCGGAGATTATCTTGGAAAGAATGTGCAGGCTCTGGAACTTAGCAATGAGGAACAAAGGAAAATACTACATGAGAACAATGGGAACCCTGTCCCAGCAAAGGTCGCCAAAGTAAAGGCCCTATGTAAAGAACTCAATCTTCAGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

125

Amino Acids

13.92

Weight (kDa)

5.1

Isoelectric Point (pI)

40.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CTP_synth_N PF06418 40 - 97 7.5e-20 CTP synthase N-terminus
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 3 cut(s) 145, 223, 228
AciI CCGC 3 cut(s) 145, 223, 228
AcuI CTGAAG 1 cut(s) 350
AfiI CCNNNNNNNGG 1 cut(s) 325
AgsI TTSAA 1 cut(s) 44
AjnI CCWGG 2 cut(s) 75, 129
AluBI AGCT 2 cut(s) 12, 49
AluI AGCT 2 cut(s) 12, 49
AlwNI CAGNNNCTG 1 cut(s) 259
AoxI GGCC 1 cut(s) 342
ApeKI GCWGC 1 cut(s) 12
AspS9I GGNCC 2 cut(s) 66, 343
AvaII GGWCC 1 cut(s) 66
BciT130I CCWGG 2 cut(s) 77, 131
BfaI CTAG 1 cut(s) 168
BisI GCNGC 1 cut(s) 13
BlsI GCNGC 1 cut(s) 14
Bme1390I CCNGG 2 cut(s) 77, 131
Bme18I GGWCC 1 cut(s) 66
BmgT120I GGNCC 2 cut(s) 66, 343
BmiI GGNNCC 2 cut(s) 67, 311
BmrFI CCNGG 2 cut(s) 77, 131
BsaJI CCNNGG 1 cut(s) 130
Bsc4I CCNNNNNNNGG 1 cut(s) 325
Bse1I ACTGG 1 cut(s) 16
Bse3DI GCAATG 1 cut(s) 277
BseBI CCWGG 2 cut(s) 77, 131
BseDI CCNNGG 1 cut(s) 130
BseLI CCNNNNNNNGG 1 cut(s) 325
BseMI GCAATG 1 cut(s) 277
BseMII CTCAG 1 cut(s) 105
BseNI ACTGG 1 cut(s) 16
BseRI GAGGAG 2 cut(s) 96, 99
BseYI CCCAGC 1 cut(s) 319
BsgI GTGCAG 1 cut(s) 272
BshFI GGCC 1 cut(s) 344
BslFI GGGAC 3 cut(s) 79, 185, 302
BslI CCNNNNNNNGG 1 cut(s) 325
BsmFI GGGAC 3 cut(s) 79, 185, 302
BsnI GGCC 1 cut(s) 344
BspACI CCGC 3 cut(s) 145, 223, 228
BspANI GGCC 1 cut(s) 344
BspCNI CTCAG 1 cut(s) 104
BspLI GGNNCC 2 cut(s) 67, 311
BsrBI CCGCTC 3 cut(s) 145, 223, 228
BsrDI GCAATG 1 cut(s) 277
BsrI ACTGG 1 cut(s) 16
BssECI CCNNGG 1 cut(s) 130
Bst2UI CCWGG 2 cut(s) 77, 131
BstC8I GCNNGC 1 cut(s) 255
BstDEI CTNAG 2 cut(s) 91, 266
BstMWI GCNNNNNNNGC 1 cut(s) 329
BstNI CCWGG 2 cut(s) 77, 131
BstSCI CCNGG 2 cut(s) 75, 129
BstXI CCANNNNNNTGG 1 cut(s) 23
BsuRI GGCC 1 cut(s) 344
Cac8I GCNNGC 1 cut(s) 255
CaiI CAGNNNCTG 1 cut(s) 259
Cfr13I GGNCC 2 cut(s) 66, 343
CviAII CATG 1 cut(s) 296
CviJI RGCY 5 cut(s) 12, 49, 96, 257, 344
CviKI_1 RGCY 5 cut(s) 12, 49, 96, 257, 344
DdeI CTNAG 2 cut(s) 91, 266
Eco47I GGWCC 1 cut(s) 66
Eco57I CTGAAG 1 cut(s) 350
EcoO109I RGGNCCY 2 cut(s) 66, 343
EcoRII CCWGG 2 cut(s) 75, 129
FaeI CATG 1 cut(s) 299
FaiI YATR 7 cut(s) 73, 99, 101, 199, 213, 297, 349
FaqI GGGAC 3 cut(s) 79, 185, 302
FatI CATG 1 cut(s) 295
Fnu4HI GCNGC 1 cut(s) 13
Fsp4HI GCNGC 1 cut(s) 13
FspBI CTAG 1 cut(s) 168
GluI GCNGC 1 cut(s) 13
GsaI CCCAGC 1 cut(s) 323
HaeIII GGCC 1 cut(s) 344
Hin1II CATG 1 cut(s) 299
HinfI GANTC 1 cut(s) 160
Hpy188III TCNNGA 1 cut(s) 260
Hpy99I CGWCG 1 cut(s) 190
HpyCH4V TGCA 1 cut(s) 253
HpyF10VI GCNNNNNNNGC 1 cut(s) 329
HpyF3I CTNAG 2 cut(s) 91, 266
Hsp92II CATG 1 cut(s) 299
LmnI GCTCC 2 cut(s) 220, 225
MaeI CTAG 1 cut(s) 168
MaeIII GTNAC 4 cut(s) 53, 134, 157, 181
MbiI CCGCTC 3 cut(s) 145, 223, 228
MboII GAAGA 1 cut(s) 356
MluCI AATT 1 cut(s) 28
MlyI GAGTC 1 cut(s) 154
MnlI CCTC 5 cut(s) 79, 114, 117, 120, 268
MspR9I CCNGG 2 cut(s) 77, 131
MvaI CCWGG 2 cut(s) 77, 131
MwoI GCNNNNNNNGC 1 cut(s) 329
NlaIII CATG 1 cut(s) 299
NlaIV GGNNCC 2 cut(s) 67, 311
NmuCI GTSAC 1 cut(s) 157
PcsI WCGNNNNNNNCGW 1 cut(s) 147
PkrI GCNGC 1 cut(s) 14
PleI GAGTC 1 cut(s) 154
PpsI GAGTC 1 cut(s) 154
PpuMI RGGWCCY 1 cut(s) 66
Psp5II RGGWCCY 1 cut(s) 66
Psp6I CCWGG 2 cut(s) 75, 129
PspFI CCCAGC 1 cut(s) 319
PspGI CCWGG 2 cut(s) 75, 129
PspN4I GGNNCC 2 cut(s) 67, 311
PspPI GGNCC 2 cut(s) 66, 343
PspPPI RGGWCCY 1 cut(s) 66
PstNI CAGNNNCTG 1 cut(s) 259
SatI GCNGC 1 cut(s) 13
Sau96I GGNCC 2 cut(s) 66, 343
SchI GAGTC 1 cut(s) 154
ScrFI CCNGG 2 cut(s) 77, 131
SetI ASST 5 cut(s) 14, 51, 71, 132, 330
SinI GGWCC 1 cut(s) 66
Sse9I AATT 1 cut(s) 28
SsiI CCGC 3 cut(s) 145, 223, 228
SspMI CTAG 1 cut(s) 168
StyD4I CCNGG 2 cut(s) 75, 129
TaqI TCGA 1 cut(s) 20
TasI AATT 1 cut(s) 28
TseFI GTSAC 1 cut(s) 157
TseI GCWGC 1 cut(s) 12
Tsp45I GTSAC 1 cut(s) 157
VpaK11BI GGWCC 1 cut(s) 66
XspI CTAG 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.