Rroxscaffold_1G00035060

Catalyzes the ATP-dependent amination of UTP to CTP with either L-glutamine or ammonia as the source of nitrogen

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0004269
Physical Location & Seq
Reverse (-)
50992075 .. 51005044
12970 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00035060.1

Sequence Viewer

Length: 330 bp
ATGAAAGTTCTCCATCTAAGCATGCCGCTTGCCGCCGCTGCTACGGGCCGCGCCGTGTGCAAGGTTGCCACAAACAGTGCGCAAGGACCATACGAAGCCAATGGAAGAAGTTTGGTTGATTTAGACCTGGGTAACTACGAGCGGTTCGTAGATGTGACTCTTACTAGGGACAACAACGTTACGTCGGGAAAGATATATCAGACTGTGTATGACAAGGAGCGGAGCAGAGATTATCTTGGAAAGACTATGCAGGAGAACAATGGGAACCCTGACCCAACAAAGGTCGCCAAAGTAAAGGCCCTATGTAAAGAACTCAATCTTCAGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00240 ko01100 map00240 map01100
Pfam Domains
Protein Families
CTP_synth_N GATase

Protein Analysis

109

Amino Acids

12.04

Weight (kDa)

8.93

Isoelectric Point (pI)

9.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CTP_synth_N PF06418 39 - 84 6.8e-18 CTP synthase N-terminus
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 81
AccBSI CCGCTC 2 cut(s) 142, 220
AccII CGCG 1 cut(s) 51
AciI CCGC 6 cut(s) 26, 33, 36, 49, 142, 220
AclI AACGTT 1 cut(s) 177
AcuI CTGAAG 1 cut(s) 305
AfiI CCNNNNNNNGG 1 cut(s) 280
AjnI CCWGG 1 cut(s) 126
AoxI GGCC 2 cut(s) 46, 297
ApeKI GCWGC 1 cut(s) 38
AspLEI GCGC 2 cut(s) 53, 82
AspS9I GGNCC 3 cut(s) 46, 86, 298
AvaII GGWCC 1 cut(s) 86
BbvI GCAGC 1 cut(s) 25
BccI CCATC 1 cut(s) 21
BceAI ACGGC 1 cut(s) 38
BciT130I CCWGG 1 cut(s) 128
BfaI CTAG 1 cut(s) 165
BisI GCNGC 5 cut(s) 26, 33, 36, 39, 49
BlsI GCNGC 5 cut(s) 27, 34, 37, 40, 50
Bme1390I CCNGG 1 cut(s) 128
Bme18I GGWCC 1 cut(s) 86
BmgT120I GGNCC 3 cut(s) 46, 86, 298
BmiI GGNNCC 1 cut(s) 266
BmrFI CCNGG 1 cut(s) 128
BsaJI CCNNGG 1 cut(s) 127
Bsc4I CCNNNNNNNGG 1 cut(s) 280
BseBI CCWGG 1 cut(s) 128
BseDI CCNNGG 1 cut(s) 127
BseLI CCNNNNNNNGG 1 cut(s) 280
BseXI GCAGC 1 cut(s) 25
Bsh1236I CGCG 1 cut(s) 51
BshFI GGCC 2 cut(s) 48, 299
BslFI GGGAC 1 cut(s) 182
BslI CCNNNNNNNGG 1 cut(s) 280
BsmFI GGGAC 1 cut(s) 182
BsnI GGCC 2 cut(s) 48, 299
BspACI CCGC 6 cut(s) 26, 33, 36, 49, 142, 220
BspANI GGCC 2 cut(s) 48, 299
BspFNI CGCG 1 cut(s) 51
BspLI GGNNCC 1 cut(s) 266
BsrBI CCGCTC 2 cut(s) 142, 220
BssECI CCNNGG 1 cut(s) 127
Bst2UI CCWGG 1 cut(s) 128
Bst4CI ACNGT 2 cut(s) 77, 205
BstC8I GCNNGC 2 cut(s) 23, 30
BstDEI CTNAG 1 cut(s) 17
BstFNI CGCG 1 cut(s) 51
BstHHI GCGC 2 cut(s) 53, 82
BstMWI GCNNNNNNNGC 2 cut(s) 38, 57
BstNI CCWGG 1 cut(s) 128
BstNSI RCATGY 1 cut(s) 25
BstSCI CCNGG 1 cut(s) 126
BstUI CGCG 1 cut(s) 51
BstV1I GCAGC 1 cut(s) 25
BsuRI GGCC 2 cut(s) 48, 299
BtsIMutI CAGTG 1 cut(s) 82
Cac8I GCNNGC 2 cut(s) 23, 30
CfoI GCGC 2 cut(s) 53, 82
Cfr13I GGNCC 3 cut(s) 46, 86, 298
CviAII CATG 1 cut(s) 22
CviJI RGCY 3 cut(s) 48, 98, 299
CviKI_1 RGCY 3 cut(s) 48, 98, 299
DdeI CTNAG 1 cut(s) 17
Eco47I GGWCC 1 cut(s) 86
Eco57I CTGAAG 1 cut(s) 305
EcoO109I RGGNCCY 1 cut(s) 298
EcoRII CCWGG 1 cut(s) 126
FaeI CATG 1 cut(s) 25
FaiI YATR 6 cut(s) 23, 91, 196, 210, 248, 304
FaqI GGGAC 1 cut(s) 182
FatI CATG 1 cut(s) 21
Fnu4HI GCNGC 5 cut(s) 26, 33, 36, 39, 49
Fsp4HI GCNGC 5 cut(s) 26, 33, 36, 39, 49
FspBI CTAG 1 cut(s) 165
FspI TGCGCA 1 cut(s) 81
GlaI GCGC 2 cut(s) 52, 81
GluI GCNGC 5 cut(s) 26, 33, 36, 39, 49
HaeIII GGCC 2 cut(s) 48, 299
HhaI GCGC 2 cut(s) 53, 82
Hin1II CATG 1 cut(s) 25
Hin6I GCGC 2 cut(s) 51, 80
HinP1I GCGC 2 cut(s) 51, 80
HinfI GANTC 1 cut(s) 157
Hpy188I TCNGA 1 cut(s) 201
Hpy188III TCNNGA 1 cut(s) 186
Hpy99I CGWCG 1 cut(s) 187
HpyCH4III ACNGT 2 cut(s) 77, 205
HpyCH4IV ACGT 2 cut(s) 177, 182
HpyCH4V TGCA 2 cut(s) 60, 250
HpyF10VI GCNNNNNNNGC 2 cut(s) 38, 57
HpyF3I CTNAG 1 cut(s) 17
HpySE526I ACGT 2 cut(s) 177, 182
Hsp92II CATG 1 cut(s) 25
HspAI GCGC 2 cut(s) 51, 80
LmnI GCTCC 2 cut(s) 217, 222
LpnPI CCDG 4 cut(s) 113, 140, 236, 282
Lsp1109I GCAGC 1 cut(s) 25
MaeI CTAG 1 cut(s) 165
MaeII ACGT 2 cut(s) 177, 182
MaeIII GTNAC 3 cut(s) 131, 154, 178
MbiI CCGCTC 2 cut(s) 142, 220
MboII GAAGA 2 cut(s) 117, 311
MlyI GAGTC 1 cut(s) 151
MspA1I CMGCKG 1 cut(s) 38
MspR9I CCNGG 1 cut(s) 128
MvaI CCWGG 1 cut(s) 128
MvnI CGCG 1 cut(s) 51
MwoI GCNNNNNNNGC 2 cut(s) 38, 57
NlaIII CATG 1 cut(s) 25
NlaIV GGNNCC 1 cut(s) 266
NmuCI GTSAC 1 cut(s) 154
NsbI TGCGCA 1 cut(s) 81
NspI RCATGY 1 cut(s) 25
PaeI GCATGC 1 cut(s) 25
PcsI WCGNNNNNNNCGW 1 cut(s) 144
PkrI GCNGC 5 cut(s) 27, 34, 37, 40, 50
PleI GAGTC 1 cut(s) 151
PpsI GAGTC 1 cut(s) 151
Psp1406I AACGTT 1 cut(s) 177
Psp6I CCWGG 1 cut(s) 126
PspGI CCWGG 1 cut(s) 126
PspN4I GGNNCC 1 cut(s) 266
PspPI GGNCC 3 cut(s) 46, 86, 298
SatI GCNGC 5 cut(s) 26, 33, 36, 39, 49
Sau96I GGNCC 3 cut(s) 46, 86, 298
SchI GAGTC 1 cut(s) 151
ScrFI CCNGG 1 cut(s) 128
SetI ASST 5 cut(s) 66, 129, 180, 185, 285
SinI GGWCC 1 cut(s) 86
SphI GCATGC 1 cut(s) 25
SsiI CCGC 6 cut(s) 26, 33, 36, 49, 142, 220
SspMI CTAG 1 cut(s) 165
StyD4I CCNGG 1 cut(s) 126
TaaI ACNGT 2 cut(s) 77, 205
TaiI ACGT 2 cut(s) 180, 185
TauI GCSGC 4 cut(s) 28, 35, 38, 51
TscAI CASTG 1 cut(s) 82
TseFI GTSAC 1 cut(s) 154
TseI GCWGC 1 cut(s) 38
Tsp45I GTSAC 1 cut(s) 154
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 82
VpaK11BI GGWCC 1 cut(s) 86
XceI RCATGY 1 cut(s) 25
XspI CTAG 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.