Rmu_sc0038379.1_g000001

Catalyzes the ATP-dependent amination of UTP to CTP with either L-glutamine or ammonia as the source of nitrogen

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0038379.1
Physical Location & Seq
Reverse (-)
1 .. 511
511 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0038379.1_g000001.1.cds

Sequence Viewer

Length: 275 bp
atgtctccctttgaacacggcgaggtttttgttcttgatgatggtggagaggttgatttagacctgggtaactacgaacgcttcgtagatgtgactcttactagggacaacaacattacgacgggcaagatatatcagtcggtccttgacaaggagcggagaggggattatcttggaaagactgtgcaggtgatgaaggacaatcatattttttgttatcctcaacgcttaaaagtactgatgactggcttcccgtggtctttgagtggatgtag

Protein Analysis

91

Amino Acids

10.42

Weight (kDa)

4.96

Isoelectric Point (pI)

29.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 178
Acc36I ACCTGC 1 cut(s) 178
AccBSI CCGCTC 1 cut(s) 157
AciI CCGC 1 cut(s) 157
AfaI GTAC 1 cut(s) 237
AfiI CCNNNNNNNGG 1 cut(s) 151
AgsI TTSAA 1 cut(s) 14
AjnI CCWGG 1 cut(s) 63
Alw26I GTCTC 1 cut(s) 9
AspS9I GGNCC 1 cut(s) 142
AsuHPI GGTGA 1 cut(s) 202
AvaII GGWCC 1 cut(s) 142
BccI CCATC 1 cut(s) 35
BceAI ACGGC 1 cut(s) 34
BciT130I CCWGG 1 cut(s) 65
BcoDI GTCTC 1 cut(s) 9
BfaI CTAG 1 cut(s) 102
BfuAI ACCTGC 1 cut(s) 178
BmcAI AGTACT 1 cut(s) 237
Bme1390I CCNGG 1 cut(s) 65
Bme18I GGWCC 1 cut(s) 142
BmgT120I GGNCC 1 cut(s) 142
BmrFI CCNGG 1 cut(s) 65
BsaJI CCNNGG 2 cut(s) 64, 254
Bsc4I CCNNNNNNNGG 1 cut(s) 151
Bse1I ACTGG 1 cut(s) 250
BseBI CCWGG 1 cut(s) 65
BseDI CCNNGG 2 cut(s) 64, 254
BseGI GGATG 1 cut(s) 275
BseLI CCNNNNNNNGG 1 cut(s) 151
BseNI ACTGG 1 cut(s) 250
BsgI GTGCAG 1 cut(s) 206
BslFI GGGAC 1 cut(s) 119
BslI CCNNNNNNNGG 1 cut(s) 151
BsmAI GTCTC 1 cut(s) 9
BsmFI GGGAC 1 cut(s) 119
BspACI CCGC 1 cut(s) 157
BspMI ACCTGC 1 cut(s) 178
BsrBI CCGCTC 1 cut(s) 157
BsrI ACTGG 1 cut(s) 250
BssECI CCNNGG 2 cut(s) 64, 254
Bst2UI CCWGG 1 cut(s) 65
Bst4CI ACNGT 1 cut(s) 184
BstDSI CCRYGG 1 cut(s) 254
BstENI CCTNNNNNAGG 1 cut(s) 149
BstF5I GGATG 1 cut(s) 275
BstMAI GTCTC 1 cut(s) 9
BstNI CCWGG 1 cut(s) 65
BstSCI CCNGG 1 cut(s) 63
BtgI CCRYGG 1 cut(s) 254
BtsCI GGATG 1 cut(s) 275
BveI ACCTGC 1 cut(s) 178
Cfr13I GGNCC 1 cut(s) 142
Csp6I GTAC 1 cut(s) 236
CviJI RGCY 1 cut(s) 249
CviKI_1 RGCY 1 cut(s) 249
CviQI GTAC 1 cut(s) 236
Eco47I GGWCC 1 cut(s) 142
EcoNI CCTNNNNNAGG 1 cut(s) 149
EcoRII CCWGG 1 cut(s) 63
FaiI YATR 2 cut(s) 133, 207
FaqI GGGAC 1 cut(s) 119
FspBI CTAG 1 cut(s) 102
HinfI GANTC 1 cut(s) 94
HphI GGTGA 1 cut(s) 202
Hpy188III TCNNGA 1 cut(s) 35
Hpy99I CGWCG 1 cut(s) 124
HpyAV CCTTC 1 cut(s) 190
HpyCH4III ACNGT 1 cut(s) 184
HpyCH4V TGCA 1 cut(s) 187
LmnI GCTCC 1 cut(s) 154
LpnPI CCDG 4 cut(s) 50, 77, 173, 231
MaeI CTAG 1 cut(s) 102
MaeIII GTNAC 2 cut(s) 68, 91
MbiI CCGCTC 1 cut(s) 157
MlyI GAGTC 1 cut(s) 88
MnlI CCTC 4 cut(s) 16, 43, 155, 231
MseI TTAA 1 cut(s) 230
MspR9I CCNGG 1 cut(s) 65
MvaI CCWGG 1 cut(s) 65
NmuCI GTSAC 1 cut(s) 91
PaqCI CACCTGC 1 cut(s) 178
PcsI WCGNNNNNNNCGW 1 cut(s) 81
PleI GAGTC 1 cut(s) 88
PpsI GAGTC 1 cut(s) 88
Psp6I CCWGG 1 cut(s) 63
PspGI CCWGG 1 cut(s) 63
PspPI GGNCC 1 cut(s) 142
RsaI GTAC 1 cut(s) 237
RsaNI GTAC 1 cut(s) 236
SaqAI TTAA 1 cut(s) 230
Sau96I GGNCC 1 cut(s) 142
ScaI AGTACT 1 cut(s) 237
SchI GAGTC 1 cut(s) 88
ScrFI CCNGG 1 cut(s) 65
SetI ASST 4 cut(s) 27, 54, 66, 192
SinI GGWCC 1 cut(s) 142
SsiI CCGC 1 cut(s) 157
SspMI CTAG 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 63
TaaI ACNGT 1 cut(s) 184
TaqII GACCGA 1 cut(s) 130
TatI WGTACW 1 cut(s) 235
Tru1I TTAA 1 cut(s) 230
Tru9I TTAA 1 cut(s) 230
TseFI GTSAC 1 cut(s) 91
Tsp45I GTSAC 1 cut(s) 91
TspDTI ATGAA 1 cut(s) 209
VpaK11BI GGWCC 1 cut(s) 142
XagI CCTNNNNNAGG 1 cut(s) 149
XspI CTAG 1 cut(s) 102
ZrmI AGTACT 1 cut(s) 237
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.