Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8047706.1

Orthogroup ID

OG0010155

Physical Location & Seq

Genomic Coordinates Forward (+)

137 .. 558

Gene Structure 422 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8047706.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 422 bp

atgccagaaagagatgctgttacattcaatgcattgataacagggtactcgaaagatgggttgaatgaaggtgctattaacctctttgctgaaatgcaaaatctgggttacaagccttctgaatttacatttgcagcagtactttgtgccggtatcggtttagatgacattgtgcttgggcaacaggttcatggttttgtggttaagactaattttgtttggaatgtttttgtgggaaatgcattgctcgatttctactcaaagcatgactatgtggttgaagcaaggaaactttttgatgagatgccagagttggattgtatttcttacaatataatcatctcctcctatgtatgggatgggcaatttaaagaggctcttgatcttttccgtgaattgcagcttaccaaatatgaccggaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

140

Amino Acids

15.92

Weight (kDa)

4.51

Isoelectric Point (pI)

23.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010155)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G02010
malus_domestica	MD09G1003500.v1.1
prunus_persica	Prupe.3G313000_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0139751
rosa_laevigata	RLG00000019830
rosa_multiflora	Rmu_co8047706.1_g000001 Rmu_sc0009714.1_g000012
rosa_roxburghii	Rroxscaffold_2G00105230
rosa_rugosa	Rorug02G0359700 Rorug02G0359800 Rorug02G0359900 Rorug04G0363900
rosa_samantha	Rh2AG409400 Rh2AG409500 Rh2BG419800 Rh2BG419900 Rh2CG395700 Rh2CG395800 Rh2DG429300 Rh4CG451800
rosa_wichuraiana	Rw2G033420

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	122
AfaI	GTAC	2 cut(s)	47, 141
AfiI	CCNNNNNNNGG	1 cut(s)	354
AgsI	TTSAA	3 cut(s)	28, 64, 281
AluBI	AGCT	1 cut(s)	403
AluI	AGCT	1 cut(s)	403
ApeKI	GCWGC	2 cut(s)	134, 400
ApoI	RAATTY	1 cut(s)	122
BbvI	GCAGC	2 cut(s)	146, 412
BccI	CCATC	2 cut(s)	50, 353
BisI	GCNGC	2 cut(s)	135, 401
BlsI	GCNGC	2 cut(s)	136, 402
BmcAI	AGTACT	1 cut(s)	141
BmsI	GCATC	2 cut(s)	4, 294
BsaWI	WCCGGW	1 cut(s)	417
Bsc4I	CCNNNNNNNGG	1 cut(s)	354
Bse118I	RCCGGY	1 cut(s)	149
Bse3DI	GCAATG	1 cut(s)	242
BseGI	GGATG	1 cut(s)	364
BseLI	CCNNNNNNNGG	1 cut(s)	354
BseMI	GCAATG	1 cut(s)	242
BseRI	GAGGAG	1 cut(s)	334
BseXI	GCAGC	2 cut(s)	146, 412
BsiSI	CCGG	2 cut(s)	150, 418
BslI	CCNNNNNNNGG	1 cut(s)	354
Bsp143I	GATC	1 cut(s)	382
BsrDI	GCAATG	1 cut(s)	242
BsrFI	RCCGGY	1 cut(s)	149
BssAI	RCCGGY	1 cut(s)	149
BssMI	GATC	1 cut(s)	382
BstF5I	GGATG	1 cut(s)	364
BstKTI	GATC	1 cut(s)	385
BstMBI	GATC	1 cut(s)	382
BstV1I	GCAGC	2 cut(s)	146, 412
BtsCI	GGATG	1 cut(s)	364
Cfr10I	RCCGGY	1 cut(s)	149
Csp6I	GTAC	2 cut(s)	46, 140
CviAII	CATG	2 cut(s)	191, 266
CviJI	RGCY	3 cut(s)	115, 377, 403
CviKI_1	RGCY	3 cut(s)	115, 377, 403
CviQI	GTAC	2 cut(s)	46, 140
DpnI	GATC	1 cut(s)	384
DpnII	GATC	1 cut(s)	382
DraI	TTTAAA	1 cut(s)	370
EcoT22I	ATGCAT	2 cut(s)	34, 244
FaeI	CATG	2 cut(s)	194, 269
FaiI	YATR	7 cut(s)	192, 267, 273, 335, 351, 355, 414
FalI	AAGNNNNNCTT	2 cut(s)	363, 395
FatI	CATG	2 cut(s)	190, 265
Fnu4HI	GCNGC	2 cut(s)	135, 401
FokI	GGATG	1 cut(s)	371
Fsp4HI	GCNGC	2 cut(s)	135, 401
GluI	GCNGC	2 cut(s)	135, 401
HapII	CCGG	2 cut(s)	150, 418
Hin1II	CATG	2 cut(s)	194, 269
HpaII	CCGG	2 cut(s)	150, 418
Hpy188I	TCNGA	1 cut(s)	121
Hpy188III	TCNNGA	1 cut(s)	380
HpyAV	CCTTC	2 cut(s)	62, 126
HpyCH4V	TGCA	5 cut(s)	32, 97, 134, 242, 400
Hsp92II	CATG	2 cut(s)	194, 269
Kzo9I	GATC	1 cut(s)	382
LpnPI	CCDG	6 cut(s)	18, 27, 89, 163, 170, 321
Lsp1109I	GCAGC	2 cut(s)	146, 412
LweI	GCATC	2 cut(s)	4, 294
MaeIII	GTNAC	2 cut(s)	19, 107
MalI	GATC	1 cut(s)	384
MboI	GATC	1 cut(s)	382
MluCI	AATT	4 cut(s)	122, 211, 365, 395
MmeI	TCCRAC	1 cut(s)	294
MnlI	CCTC	3 cut(s)	92, 355, 367
Mph1103I	ATGCAT	2 cut(s)	34, 244
MseI	TTAA	3 cut(s)	78, 204, 369
MslI	CAYNNNNRTG	1 cut(s)	270
MspI	CCGG	2 cut(s)	150, 418
NdeII	GATC	1 cut(s)	382
NlaIII	CATG	2 cut(s)	194, 269
NsiI	ATGCAT	2 cut(s)	34, 244
PkrI	GCNGC	2 cut(s)	136, 402
RsaI	GTAC	2 cut(s)	47, 141
RsaNI	GTAC	2 cut(s)	46, 140
RseI	CAYNNNNRTG	1 cut(s)	270
SaqAI	TTAA	3 cut(s)	78, 204, 369
SatI	GCNGC	2 cut(s)	135, 401
Sau3AI	GATC	1 cut(s)	382
ScaI	AGTACT	1 cut(s)	141
SetI	ASST	4 cut(s)	73, 84, 189, 405
SfaNI	GCATC	2 cut(s)	4, 294
SmiMI	CAYNNNNRTG	1 cut(s)	270
Sse9I	AATT	4 cut(s)	122, 211, 365, 395
TaqI	TCGA	2 cut(s)	50, 249
TasI	AATT	4 cut(s)	122, 211, 365, 395
TatI	WGTACW	1 cut(s)	139
Tru1I	TTAA	3 cut(s)	78, 204, 369
Tru9I	TTAA	3 cut(s)	78, 204, 369
TseI	GCWGC	2 cut(s)	134, 400
TspDTI	ATGAA	2 cut(s)	81, 179
TspGWI	ACGGA	1 cut(s)	380
XapI	RAATTY	1 cut(s)	122
ZrmI	AGTACT	1 cut(s)	141
Zsp2I	ATGCAT	2 cut(s)	34, 244

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.