Rh2CG395700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
53803598 .. 53804552
955 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG395700.1

Sequence Viewer

Length: 348 bp
ATGTTGTGTTTGATTGGTTTTGCCTCTAAACTGATACTAAGTTTCCAGGCAGTAATGTTATTCTACAATATTCATAATCCTACTTGGAGTATTATCTGTGTCCTCTTTCAGGTAACACCAGTTTTGAATCTTGATATGGAGTTATTGCATGCAACTAGCAAGGGCCTGTTCATGACACCAATATTATTATTTGAAAAAATATGCCTCAGTGCTCTGCCCATCCAGCCATCTCTTCTCATAGTCGAACAGGACAGACAAATAGTGGAGATATGCTACTTTTCTGCAACATATAATGTCCCCAGAGGTAAGGACAAAGTTCCAATTGTAAATTTCCATGTCTTTTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

13.1

Weight (kDa)

6.8

Isoelectric Point (pI)

29.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 328
AfiI CCNNNNNNNGG 1 cut(s) 109
AgsI TTSAA 2 cut(s) 127, 194
AjnI CCWGG 1 cut(s) 45
Alw21I GWGCWC 1 cut(s) 214
AoxI GGCC 1 cut(s) 163
ApoI RAATTY 1 cut(s) 328
AspS9I GGNCC 1 cut(s) 163
Bbv12I GWGCWC 1 cut(s) 214
BccI CCATC 2 cut(s) 227, 235
BciT130I CCWGG 1 cut(s) 47
BfaI CTAG 1 cut(s) 156
Bme1390I CCNGG 1 cut(s) 47
BmgT120I GGNCC 1 cut(s) 163
BmrFI CCNGG 1 cut(s) 47
Bsc4I CCNNNNNNNGG 1 cut(s) 109
Bse1I ACTGG 1 cut(s) 119
BseBI CCWGG 1 cut(s) 47
BseGI GGATG 1 cut(s) 219
BseLI CCNNNNNNNGG 1 cut(s) 109
BseMII CTCAG 1 cut(s) 220
BseNI ACTGG 1 cut(s) 119
BshFI GGCC 1 cut(s) 165
BsiHKAI GWGCWC 1 cut(s) 214
BslFI GGGAC 1 cut(s) 281
BslI CCNNNNNNNGG 1 cut(s) 109
BsmFI GGGAC 1 cut(s) 281
BsnI GGCC 1 cut(s) 165
Bsp1286I GDGCHC 1 cut(s) 214
BspANI GGCC 1 cut(s) 165
BspCNI CTCAG 1 cut(s) 219
BspHI TCATGA 1 cut(s) 171
BsrI ACTGG 1 cut(s) 119
Bst2UI CCWGG 1 cut(s) 47
Bst6I CTCTTC 1 cut(s) 237
BstC8I GCNNGC 1 cut(s) 150
BstDEI CTNAG 2 cut(s) 38, 206
BstENI CCTNNNNNAGG 1 cut(s) 107
BstF5I GGATG 1 cut(s) 219
BstMWI GCNNNNNNNGC 1 cut(s) 223
BstNI CCWGG 1 cut(s) 47
BstNSI RCATGY 1 cut(s) 152
BstSCI CCNGG 1 cut(s) 45
BsuRI GGCC 1 cut(s) 165
BtsCI GGATG 1 cut(s) 219
BtsIMutI CAGTG 1 cut(s) 214
Cac8I GCNNGC 1 cut(s) 150
CciI TCATGA 1 cut(s) 171
Cfr13I GGNCC 1 cut(s) 163
CviAII CATG 3 cut(s) 149, 172, 335
CviJI RGCY 2 cut(s) 165, 226
CviKI_1 RGCY 2 cut(s) 165, 226
DdeI CTNAG 2 cut(s) 38, 206
Eam1104I CTCTTC 1 cut(s) 237
EarI CTCTTC 1 cut(s) 237
EcoNI CCTNNNNNAGG 1 cut(s) 107
EcoO109I RGGNCCY 1 cut(s) 163
EcoRII CCWGG 1 cut(s) 45
FaeI CATG 3 cut(s) 152, 175, 338
FaqI GGGAC 1 cut(s) 281
FatI CATG 3 cut(s) 148, 171, 334
FokI GGATG 1 cut(s) 206
FspBI CTAG 1 cut(s) 156
HaeIII GGCC 1 cut(s) 165
Hin1II CATG 3 cut(s) 152, 175, 338
HinfI GANTC 1 cut(s) 127
Hpy188III TCNNGA 2 cut(s) 131, 172
HpyCH4V TGCA 3 cut(s) 148, 152, 284
HpyF10VI GCNNNNNNNGC 1 cut(s) 223
HpyF3I CTNAG 2 cut(s) 38, 206
Hsp92II CATG 3 cut(s) 152, 175, 338
LpnPI CCDG 8 cut(s) 32, 59, 95, 132, 179, 233, 236, 313
MaeI CTAG 1 cut(s) 156
MaeIII GTNAC 1 cut(s) 112
MboII GAAGA 1 cut(s) 224
MfeI CAATTG 1 cut(s) 321
MhlI GDGCHC 1 cut(s) 214
MluCI AATT 2 cut(s) 321, 328
MnlI CCTC 4 cut(s) 34, 113, 215, 296
MspR9I CCNGG 1 cut(s) 47
MunI CAATTG 1 cut(s) 321
MvaI CCWGG 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 223
NlaIII CATG 3 cut(s) 152, 175, 338
NspI RCATGY 1 cut(s) 152
PaeI GCATGC 1 cut(s) 152
PagI TCATGA 1 cut(s) 171
PfeI GAWTC 1 cut(s) 127
Psp6I CCWGG 1 cut(s) 45
PspGI CCWGG 1 cut(s) 45
PspPI GGNCC 1 cut(s) 163
Sau96I GGNCC 1 cut(s) 163
ScrFI CCNGG 1 cut(s) 47
SduI GDGCHC 1 cut(s) 214
SetI ASST 2 cut(s) 114, 307
SphI GCATGC 1 cut(s) 152
Sse9I AATT 2 cut(s) 321, 328
SspI AATATT 2 cut(s) 70, 183
SspMI CTAG 1 cut(s) 156
StyD4I CCNGG 1 cut(s) 45
TaqI TCGA 1 cut(s) 243
TasI AATT 2 cut(s) 321, 328
TfiI GAWTC 1 cut(s) 127
TscAI CASTG 1 cut(s) 214
TspDTI ATGAA 2 cut(s) 62, 160
TspRI CASTG 1 cut(s) 214
XagI CCTNNNNNAGG 1 cut(s) 107
XapI RAATTY 1 cut(s) 328
XceI RCATGY 1 cut(s) 152
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.