Rmu_co8060254.1_g000001

Receptor-like cytosolic serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8060254.1
Physical Location & Seq
Reverse (-)
2 .. 191
190 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8060254.1_g000001.1.cds

Sequence Viewer

Length: 190 bp
atgaagaaagaaaaagagactgaaaacttggacagagttggtgatttcttagccgagcttggggttattgctcacattagccacccgaatgctgctaaattgctcggatttggcattgatggtggtttgcacctagttctccagttttcaccacatggcagcttagcttctctactatttggtgctgcac

Protein Analysis

63

Amino Acids

6.65

Weight (kDa)

6.0

Isoelectric Point (pI)

21.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 60
AluBI AGCT 3 cut(s) 58, 162, 167
AluI AGCT 3 cut(s) 58, 162, 167
Alw26I GTCTC 1 cut(s) 11
ApeKI GCWGC 3 cut(s) 92, 159, 185
AsuHPI GGTGA 2 cut(s) 53, 141
BbvI GCAGC 3 cut(s) 79, 171, 172
BccI CCATC 1 cut(s) 113
BcoDI GTCTC 1 cut(s) 11
BfaI CTAG 1 cut(s) 134
BisI GCNGC 3 cut(s) 93, 160, 186
BlpI GCTNAGC 1 cut(s) 163
BlsI GCNGC 3 cut(s) 94, 161, 187
BpmI CTGGAG 1 cut(s) 125
Bpu1102I GCTNAGC 1 cut(s) 163
Bsc4I CCNNNNNNNGG 1 cut(s) 60
Bse1I ACTGG 1 cut(s) 142
BseLI CCNNNNNNNGG 1 cut(s) 60
BseNI ACTGG 1 cut(s) 142
BseXI GCAGC 3 cut(s) 79, 171, 172
BsgI GTGCAG 1 cut(s) 171
BslI CCNNNNNNNGG 1 cut(s) 60
BsmAI GTCTC 1 cut(s) 11
BsmI GAATGC 1 cut(s) 94
Bsp1720I GCTNAGC 1 cut(s) 163
BsrI ACTGG 1 cut(s) 142
BstDEI CTNAG 2 cut(s) 49, 163
BstMAI GTCTC 1 cut(s) 11
BstV1I GCAGC 3 cut(s) 79, 171, 172
CviAII CATG 1 cut(s) 155
CviJI RGCY 5 cut(s) 53, 58, 81, 162, 167
CviKI_1 RGCY 5 cut(s) 53, 58, 81, 162, 167
DdeI CTNAG 2 cut(s) 49, 163
FaeI CATG 1 cut(s) 158
FaiI YATR 1 cut(s) 156
FatI CATG 1 cut(s) 154
Fnu4HI GCNGC 3 cut(s) 93, 160, 186
Fsp4HI GCNGC 3 cut(s) 93, 160, 186
FspBI CTAG 1 cut(s) 134
GluI GCNGC 3 cut(s) 93, 160, 186
GsuI CTGGAG 1 cut(s) 125
Hin1II CATG 1 cut(s) 158
HphI GGTGA 2 cut(s) 53, 141
Hpy188I TCNGA 1 cut(s) 107
HpyCH4V TGCA 2 cut(s) 130, 188
HpyF3I CTNAG 2 cut(s) 49, 163
Hsp92II CATG 1 cut(s) 158
LpnPI CCDG 1 cut(s) 155
Lsp1109I GCAGC 3 cut(s) 79, 171, 172
MaeI CTAG 1 cut(s) 134
MboII GAAGA 1 cut(s) 16
MluCI AATT 1 cut(s) 98
MslI CAYNNNNRTG 1 cut(s) 87
Mva1269I GAATGC 1 cut(s) 94
NlaIII CATG 1 cut(s) 158
NmeAIII GCCGAG 1 cut(s) 79
PctI GAATGC 1 cut(s) 94
PkrI GCNGC 3 cut(s) 94, 161, 187
RseI CAYNNNNRTG 1 cut(s) 87
SatI GCNGC 3 cut(s) 93, 160, 186
SetI ASST 4 cut(s) 60, 135, 164, 169
SgeI CNNG 8 cut(s) 40, 67, 71, 97, 116, 146, 154, 167
SmiMI CAYNNNNRTG 1 cut(s) 87
Sse9I AATT 1 cut(s) 98
SspMI CTAG 1 cut(s) 134
TasI AATT 1 cut(s) 98
TseI GCWGC 3 cut(s) 92, 159, 185
TspDTI ATGAA 1 cut(s) 17
XspI CTAG 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.