Rmu_co8060680.1_g000001

Purple acid phosphatase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8060680.1
Physical Location & Seq
Reverse (-)
1 .. 552
552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8060680.1_g000001.1.cds

Sequence Viewer

Length: 330 bp
atgaaacaactgaaagtgatgaggttgttaattctgttgggtcttgtaatcatccaagaggcaacttcacatggagagcaccctctctccagaattgctattcatgaagcaacctttgctcttcatgaccttgcttatatcaaagcctctcccactgttctaggattaagggggcaagacactgaatgggtgactttggaatttggttctgaaaacccttcaactgaggattggattggagtattttctcctgctaattttagtgcttcttcctgccctgaggaaaatccaagagtttatcctccatttttgtgctctgcacctattaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

110

Amino Acids

12.15

Weight (kDa)

5.45

Isoelectric Point (pI)

44.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 200
AgsI TTSAA 1 cut(s) 222
Alw21I GWGCWC 2 cut(s) 81, 317
ApoI RAATTY 1 cut(s) 200
AsuHPI GGTGA 1 cut(s) 202
AxyI CCTNAGG 1 cut(s) 279
Bbv12I GWGCWC 2 cut(s) 81, 317
BfaI CTAG 1 cut(s) 161
BpmI CTGGAG 1 cut(s) 73
BsaXI ACNNNNNCTCC 2 cut(s) 71, 101
Bse21I CCTNAGG 1 cut(s) 279
BseGI GGATG 1 cut(s) 51
BseMII CTCAG 2 cut(s) 216, 270
BsgI GTGCAG 1 cut(s) 303
BsiHKAI GWGCWC 2 cut(s) 81, 317
Bsp1286I GDGCHC 2 cut(s) 81, 317
BspCNI CTCAG 2 cut(s) 217, 271
BspHI TCATGA 2 cut(s) 103, 124
BspQI GCTCTTC 1 cut(s) 126
Bst4CI ACNGT 1 cut(s) 157
Bst6I CTCTTC 1 cut(s) 126
BstAPI GCANNNNNTGC 1 cut(s) 116
BstDEI CTNAG 2 cut(s) 225, 279
BstF5I GGATG 1 cut(s) 51
BstMWI GCNNNNNNNGC 1 cut(s) 116
Bsu36I CCTNAGG 1 cut(s) 279
BtsCI GGATG 1 cut(s) 51
BtsIMutI CAGTG 2 cut(s) 153, 180
CciI TCATGA 2 cut(s) 103, 124
CviAII CATG 3 cut(s) 71, 104, 125
CviJI RGCY 1 cut(s) 146
CviKI_1 RGCY 1 cut(s) 146
DdeI CTNAG 2 cut(s) 225, 279
Eam1104I CTCTTC 1 cut(s) 126
EarI CTCTTC 1 cut(s) 126
Eco81I CCTNAGG 1 cut(s) 279
FaeI CATG 3 cut(s) 74, 107, 128
FaiI YATR 4 cut(s) 72, 105, 126, 138
FatI CATG 3 cut(s) 70, 103, 124
FokI GGATG 1 cut(s) 38
FspBI CTAG 1 cut(s) 161
GsuI CTGGAG 1 cut(s) 73
Hin1II CATG 3 cut(s) 74, 107, 128
HphI GGTGA 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 211
Hpy188III TCNNGA 3 cut(s) 90, 104, 125
HpyAV CCTTC 1 cut(s) 228
HpyCH4III ACNGT 1 cut(s) 157
HpyCH4V TGCA 1 cut(s) 320
HpyF10VI GCNNNNNNNGC 1 cut(s) 116
HpyF3I CTNAG 2 cut(s) 225, 279
Hsp92II CATG 3 cut(s) 74, 107, 128
LguI GCTCTTC 1 cut(s) 126
LpnPI CCDG 4 cut(s) 103, 264, 286, 291
MaeI CTAG 1 cut(s) 161
MaeIII GTNAC 1 cut(s) 190
MboII GAAGA 2 cut(s) 113, 261
MhlI GDGCHC 2 cut(s) 81, 317
MluCI AATT 4 cut(s) 30, 93, 200, 256
MnlI CCTC 7 cut(s) 15, 52, 93, 157, 220, 274, 312
MseI TTAA 3 cut(s) 29, 167, 327
MslI CAYNNNNRTG 1 cut(s) 310
MwoI GCNNNNNNNGC 1 cut(s) 116
NlaIII CATG 3 cut(s) 74, 107, 128
NmuCI GTSAC 1 cut(s) 190
PagI TCATGA 2 cut(s) 103, 124
PciSI GCTCTTC 1 cut(s) 126
RseI CAYNNNNRTG 1 cut(s) 310
SapI GCTCTTC 1 cut(s) 126
SaqAI TTAA 3 cut(s) 29, 167, 327
SduI GDGCHC 2 cut(s) 81, 317
SetI ASST 4 cut(s) 26, 116, 132, 325
SmiMI CAYNNNNRTG 1 cut(s) 310
Sse9I AATT 4 cut(s) 30, 93, 200, 256
SspMI CTAG 1 cut(s) 161
TaaI ACNGT 1 cut(s) 157
TasI AATT 4 cut(s) 30, 93, 200, 256
Tru1I TTAA 3 cut(s) 29, 167, 327
Tru9I TTAA 3 cut(s) 29, 167, 327
TscAI CASTG 2 cut(s) 160, 187
TseFI GTSAC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 190
TspDTI ATGAA 4 cut(s) 17, 92, 113, 120
TspRI CASTG 2 cut(s) 160, 187
XapI RAATTY 1 cut(s) 200
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.