Rmu_co8081762.1_g000001

DNA polymerase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8081762.1
Physical Location & Seq
Reverse (-)
1 .. 447
447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8081762.1_g000001.1.cds

Sequence Viewer

Length: 195 bp
atgatggcttataatctatgctattgcaccctggtccgatctgaagatgtacgcaaactcaaccttcctccagaatgtgtgaacaaaactccatctggagaaacatttgttaaaccgaatttgcaaaagggaattcttcctgaaattcttgaagaactaatagctgctcggaagagagcaaaagcggatttgaag

Protein Analysis

65

Amino Acids

7.36

Weight (kDa)

8.91

Isoelectric Point (pI)

71.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 12
AciI CCGC 1 cut(s) 185
AcsI RAATTY 3 cut(s) 118, 132, 144
AcuI CTGAAG 1 cut(s) 63
AfaI GTAC 1 cut(s) 51
AgsI TTSAA 2 cut(s) 152, 193
AjnI CCWGG 1 cut(s) 30
AluBI AGCT 1 cut(s) 164
AluI AGCT 1 cut(s) 164
ApeKI GCWGC 1 cut(s) 164
ApoI RAATTY 3 cut(s) 118, 132, 144
AspS9I GGNCC 1 cut(s) 34
AvaII GGWCC 1 cut(s) 34
BbvI GCAGC 1 cut(s) 151
BccI CCATC 1 cut(s) 100
BciT130I CCWGG 1 cut(s) 32
BisI GCNGC 1 cut(s) 165
BlsI GCNGC 1 cut(s) 166
Bme1390I CCNGG 1 cut(s) 32
Bme18I GGWCC 1 cut(s) 34
BmgT120I GGNCC 1 cut(s) 34
BmrFI CCNGG 1 cut(s) 32
BpmI CTGGAG 2 cut(s) 54, 117
BsaJI CCNNGG 1 cut(s) 30
BseBI CCWGG 1 cut(s) 32
BseDI CCNNGG 1 cut(s) 30
BseXI GCAGC 1 cut(s) 151
Bsp143I GATC 1 cut(s) 38
BspACI CCGC 1 cut(s) 185
BssECI CCNNGG 1 cut(s) 30
BssMI GATC 1 cut(s) 38
Bst2UI CCWGG 1 cut(s) 32
Bst6I CTCTTC 1 cut(s) 167
BstKTI GATC 1 cut(s) 41
BstMBI GATC 1 cut(s) 38
BstNI CCWGG 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 30
BstV1I GCAGC 1 cut(s) 151
Cfr13I GGNCC 1 cut(s) 34
Csp6I GTAC 1 cut(s) 50
CviJI RGCY 2 cut(s) 8, 164
CviKI_1 RGCY 2 cut(s) 8, 164
CviQI GTAC 1 cut(s) 50
DpnI GATC 1 cut(s) 40
DpnII GATC 1 cut(s) 38
Eam1104I CTCTTC 1 cut(s) 167
EarI CTCTTC 1 cut(s) 167
Eco47I GGWCC 1 cut(s) 34
Eco57I CTGAAG 1 cut(s) 63
EcoRI GAATTC 1 cut(s) 132
EcoRII CCWGG 1 cut(s) 30
FaiI YATR 2 cut(s) 12, 19
Fnu4HI GCNGC 1 cut(s) 165
Fsp4HI GCNGC 1 cut(s) 165
GluI GCNGC 1 cut(s) 165
GsuI CTGGAG 2 cut(s) 54, 117
Hpy166II GTNNAC 1 cut(s) 82
Hpy188I TCNGA 3 cut(s) 38, 43, 171
Hpy188III TCNNGA 4 cut(s) 71, 96, 140, 149
Hpy8I GTNNAC 1 cut(s) 82
HpyAV CCTTC 1 cut(s) 74
HpyCH4V TGCA 2 cut(s) 27, 124
Kzo9I GATC 1 cut(s) 38
LpnPI CCDG 5 cut(s) 17, 44, 81, 84, 153
Lsp1109I GCAGC 1 cut(s) 151
MalI GATC 1 cut(s) 40
MboI GATC 1 cut(s) 38
MboII GAAGA 4 cut(s) 56, 128, 164, 184
MluCI AATT 3 cut(s) 118, 132, 144
MnlI CCTC 1 cut(s) 78
MseI TTAA 1 cut(s) 111
MspR9I CCNGG 1 cut(s) 32
MvaI CCWGG 1 cut(s) 32
NdeII GATC 1 cut(s) 38
PkrI GCNGC 1 cut(s) 166
PsiI TTATAA 1 cut(s) 12
Psp6I CCWGG 1 cut(s) 30
PspGI CCWGG 1 cut(s) 30
PspPI GGNCC 1 cut(s) 34
RsaI GTAC 1 cut(s) 51
RsaNI GTAC 1 cut(s) 50
SaqAI TTAA 1 cut(s) 111
SatI GCNGC 1 cut(s) 165
Sau3AI GATC 1 cut(s) 38
Sau96I GGNCC 1 cut(s) 34
ScrFI CCNGG 1 cut(s) 32
SetI ASST 2 cut(s) 66, 166
SgeI CNNG 7 cut(s) 43, 44, 83, 108, 152, 161, 180
SinI GGWCC 1 cut(s) 34
Sse9I AATT 3 cut(s) 118, 132, 144
SsiI CCGC 1 cut(s) 185
StyD4I CCNGG 1 cut(s) 30
TasI AATT 3 cut(s) 118, 132, 144
Tru1I TTAA 1 cut(s) 111
Tru9I TTAA 1 cut(s) 111
TseI GCWGC 1 cut(s) 164
VpaK11BI GGWCC 1 cut(s) 34
XapI RAATTY 3 cut(s) 118, 132, 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.