Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8098730.1

Orthogroup ID

OG0018116

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 572

Gene Structure 572 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8098730.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 171 bp

atggcgacccaaggtcaagtcatcacctgcaaagcggcggtggcctgggaacccaacaagcctttggttatcgaagacgtccaggtggctccgccgcaggccggagaggtccgcgtcaagattctctacaccgctctctgccacaccgacgcgtacacctggggcggcaag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00010 ko00071 ko00350 ko00625 ko00626 ko00680 ko00830 ko00980 ko00982 ko01100 ko01110 ko01120 ko01130 ko01200 ko01220 ko05204 map00010 map00071 map00350 map00625 map00626 map00680 map00830 map00980 map00982 map01100 map01110 map01120 map01130 map01200 map01220 map05204

Pfam Domains

Protein Families

ADH_N ADH_zinc_N

Protein Analysis

57

Amino Acids

6.17

Weight (kDa)

6.52

Isoelectric Point (pI)

33.15

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018116)

Species	Orthologous Gene IDs
malus_domestica	MD07G1090400.v1.1
pyrus_communis	pycom05g00770 pycom10g00870
rosa_chinensis	RchiOBHm_Chr6g0277241 RchiOBHm_Chr7g0187481
rosa_multiflora	Rmu_co8098730.1_g000001 Rmu_sc0000030.1_g000037 Rmu_sc0000469.1_g000001 Rmu_sc0006941.1_g000001 Rmu_sc0006941.1_g000002 Rmu_sc0034709.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	35
AatII	GACGTC	1 cut(s)	81
Acc36I	ACCTGC	1 cut(s)	35
AccBSI	CCGCTC	1 cut(s)	134
AccII	CGCG	2 cut(s)	114, 152
AciI	CCGC	7 cut(s)	35, 38, 92, 95, 112, 132, 165
AcyI	GRCGYC	1 cut(s)	78
AfaI	GTAC	1 cut(s)	155
AfiI	CCNNNNNNNGG	1 cut(s)	101
AflIII	ACRYGT	1 cut(s)	150
AhdI	GACNNNNNGTC	1 cut(s)	12
AjnI	CCWGG	3 cut(s)	44, 81, 158
AoxI	GGCC	2 cut(s)	42, 99
AspS9I	GGNCC	1 cut(s)	109
AsuHPI	GGTGA	1 cut(s)	16
AvaII	GGWCC	1 cut(s)	109
BbsI	GAAGAC	1 cut(s)	81
BciT130I	CCWGG	3 cut(s)	46, 83, 160
BfuAI	ACCTGC	1 cut(s)	35
BisI	GCNGC	3 cut(s)	36, 95, 166
BlsI	GCNGC	3 cut(s)	37, 96, 167
Bme1390I	CCNGG	3 cut(s)	46, 83, 160
Bme18I	GGWCC	1 cut(s)	109
BmeRI	GACNNNNNGTC	1 cut(s)	12
BmgT120I	GGNCC	1 cut(s)	109
BmiI	GGNNCC	2 cut(s)	51, 90
BmrFI	CCNGG	3 cut(s)	46, 83, 160
BpiI	GAAGAC	1 cut(s)	81
BsaHI	GRCGYC	1 cut(s)	78
BsaJI	CCNNGG	3 cut(s)	10, 45, 159
Bsc4I	CCNNNNNNNGG	1 cut(s)	101
BseBI	CCWGG	3 cut(s)	46, 83, 160
BseDI	CCNNGG	3 cut(s)	10, 45, 159
BseLI	CCNNNNNNNGG	1 cut(s)	101
Bsh1236I	CGCG	2 cut(s)	114, 152
BshFI	GGCC	2 cut(s)	44, 101
BsiSI	CCGG	1 cut(s)	102
BslI	CCNNNNNNNGG	1 cut(s)	101
BsnI	GGCC	2 cut(s)	44, 101
BspACI	CCGC	7 cut(s)	35, 38, 92, 95, 112, 132, 165
BspANI	GGCC	2 cut(s)	44, 101
BspFNI	CGCG	2 cut(s)	114, 152
BspLI	GGNNCC	2 cut(s)	51, 90
BspMI	ACCTGC	1 cut(s)	35
BsrBI	CCGCTC	1 cut(s)	134
BssECI	CCNNGG	3 cut(s)	10, 45, 159
BssNI	GRCGYC	1 cut(s)	78
BssT1I	CCWWGG	1 cut(s)	10
Bst2UI	CCWGG	3 cut(s)	46, 83, 160
BstACI	GRCGYC	1 cut(s)	78
BstC8I	GCNNGC	1 cut(s)	99
BstFNI	CGCG	2 cut(s)	114, 152
BstMWI	GCNNNNNNNGC	1 cut(s)	41
BstNI	CCWGG	3 cut(s)	46, 83, 160
BstSCI	CCNGG	3 cut(s)	44, 81, 158
BstUI	CGCG	2 cut(s)	114, 152
BstV2I	GAAGAC	1 cut(s)	81
BsuRI	GGCC	2 cut(s)	44, 101
BveI	ACCTGC	1 cut(s)	35
Cac8I	GCNNGC	1 cut(s)	99
Cfr13I	GGNCC	1 cut(s)	109
CseI	GACGC	2 cut(s)	103, 158
Csp6I	GTAC	1 cut(s)	154
CviJI	RGCY	4 cut(s)	44, 61, 89, 101
CviKI_1	RGCY	4 cut(s)	44, 61, 89, 101
CviQI	GTAC	1 cut(s)	154
DriI	GACNNNNNGTC	1 cut(s)	12
Eam1105I	GACNNNNNGTC	1 cut(s)	12
EciI	GGCGGA	1 cut(s)	81
Eco130I	CCWWGG	1 cut(s)	10
Eco47I	GGWCC	1 cut(s)	109
EcoRII	CCWGG	3 cut(s)	44, 81, 158
EcoT14I	CCWWGG	1 cut(s)	10
ErhI	CCWWGG	1 cut(s)	10
Fnu4HI	GCNGC	3 cut(s)	36, 95, 166
Fsp4HI	GCNGC	3 cut(s)	36, 95, 166
GluI	GCNGC	3 cut(s)	36, 95, 166
HaeIII	GGCC	2 cut(s)	44, 101
HapII	CCGG	1 cut(s)	102
HgaI	GACGC	2 cut(s)	103, 158
Hin1I	GRCGYC	1 cut(s)	78
HinfI	GANTC	1 cut(s)	121
HpaII	CCGG	1 cut(s)	102
HphI	GGTGA	1 cut(s)	16
Hpy166II	GTNNAC	1 cut(s)	156
Hpy188III	TCNNGA	1 cut(s)	118
Hpy8I	GTNNAC	1 cut(s)	156
Hpy99I	CGWCG	1 cut(s)	152
HpyCH4IV	ACGT	1 cut(s)	78
HpyCH4V	TGCA	1 cut(s)	30
HpyF10VI	GCNNNNNNNGC	1 cut(s)	41
HpySE526I	ACGT	1 cut(s)	78
Hsp92I	GRCGYC	1 cut(s)	78
LmnI	GCTCC	1 cut(s)	94
LpnPI	CCDG	8 cut(s)	31, 40, 58, 68, 83, 95, 115, 145
MaeII	ACGT	1 cut(s)	78
MbiI	CCGCTC	1 cut(s)	134
MboII	GAAGA	1 cut(s)	86
MluI	ACGCGT	1 cut(s)	150
MnlI	CCTC	1 cut(s)	100
MspI	CCGG	1 cut(s)	102
MspR9I	CCNGG	3 cut(s)	46, 83, 160
MvaI	CCWGG	3 cut(s)	46, 83, 160
MvnI	CGCG	2 cut(s)	114, 152
MwoI	GCNNNNNNNGC	1 cut(s)	41
NlaIV	GGNNCC	2 cut(s)	51, 90
PaqCI	CACCTGC	1 cut(s)	35
PfeI	GAWTC	1 cut(s)	121
PkrI	GCNGC	3 cut(s)	37, 96, 167
Psp6I	CCWGG	3 cut(s)	44, 81, 158
PspGI	CCWGG	3 cut(s)	44, 81, 158
PspN4I	GGNNCC	2 cut(s)	51, 90
PspPI	GGNCC	1 cut(s)	109
RsaI	GTAC	1 cut(s)	155
RsaNI	GTAC	1 cut(s)	154
SatI	GCNGC	3 cut(s)	36, 95, 166
Sau96I	GGNCC	1 cut(s)	109
ScrFI	CCNGG	3 cut(s)	46, 83, 160
SetI	ASST	6 cut(s)	16, 29, 81, 87, 111, 161
SinI	GGWCC	1 cut(s)	109
SsiI	CCGC	7 cut(s)	35, 38, 92, 95, 112, 132, 165
StyD4I	CCNGG	3 cut(s)	44, 81, 158
StyI	CCWWGG	1 cut(s)	10
TaiI	ACGT	1 cut(s)	81
TaqI	TCGA	1 cut(s)	72
TauI	GCSGC	3 cut(s)	38, 97, 168
TfiI	GAWTC	1 cut(s)	121
VpaK11BI	GGWCC	1 cut(s)	109
XcmI	CCANNNNNNNNNTGG	1 cut(s)	61
ZraI	GACGTC	1 cut(s)	79

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.